• Теги
    • избранные теги
    • Компании2133
      • Показать ещё
      Страны / Регионы645
      • Показать ещё
      Люди320
      • Показать ещё
      Разное908
      • Показать ещё
      Формат95
      Издания112
      • Показать ещё
      Показатели128
      • Показать ещё
      Международные организации71
      • Показать ещё
Выбор редакции
30 мая, 00:29

Millions Of Americans Just Got An Artificial Boost To Their Credit Score

Back in August 2014, we first reported that in what appeared a suspicious attempt to boost the pool of eligible, credit-worthy mortgage and auto recipients, Fair Isaac, the company behind the crucial FICO score that determines every consumer's credit rating, "will stop including in its FICO credit-score calculations any record of a consumer failing to pay a bill if the bill has been paid or settled with a collection agency. The San Jose, Calif., company also will give less weight to unpaid medical bills that are with a collection agency." In doing so, the company would "make it easier for tens of millions of Americans to get loans." Then, back in March of this year, in the latest push to artificially boost FICO scores, the WSJ reported that "many tax liens and civil judgments soon will be removed from people’s credit reports, the latest in a series of moves to omit negative information from these financial scorecards. The development could help boost credit scores for millions of consumers, but could pose risks for lenders" as FICO scores remain the only widely accepted method of quantifying any individual American's credit risk, and determine how much consumers can borrow for a new house or car as well as determine their credit-card spending limit Stated simply, the definition of the all important FICO score, the most important number at the base of every mortgage application, was set for a series of "adjustments" which would push it higher for millions of Americans.     The outcome of these changes was clear for the 12 million people impacted: it "will make many people who have these types of credit-report blemishes look more creditworthy." Now, as the Wall Street Journal points out today, efforts to rig the FICO scoring process seems to be bearing some fruit.  The average credit score nationwide hit 700 in April, according to new data from Fair Isaac Corp., which is the highest since at least 2005. Meanwhile, the share of consumers deemed to be riskiest, with a score below 600, hit a new low of roughly 40 million, or 20% of U.S. adults who have FICO scores, according to Fair Isaac. That is down from 20.5% in October and a peak of 25.5% in 2010.   Of course, to be fair, we are also reaching that critical 7-year point where the previous wave of mortgage foreclosures start to magically disappear from the FICO scores of millions of Americans.  Mortgage foreclosures stay on credit reports for up to seven years dating back to the missed payment that resulted in the foreclosure. Foreclosure starts, the first stage in the process, peaked in 2009 at 2.1 million, according to Attom Data Solutions. They totaled nearly 1.8 million in 2010 and remained above one million during each of the next two years.   Personal bankruptcies are more complicated and can stay on credit reports for seven to 10 years.   Consumers who filed in 2007 for Chapter 7 protection—the most common type of bankruptcy, in which certain debts are discharged and creditors can get paid back from sales of consumers’ assets—are now starting to see those events fall off their reports. Some 500,000 Chapter 7 bankruptcy cases were filed in 2007, a figure that swelled to nearly 1.1 million in 2010, according to the Administrative Office of the U.S. Courts.   Chapter 13 bankruptcies, in which consumers enter a payment plan with creditors, usually stay on reports for at least seven years. Those filings reached a recent peak of nearly 435,000 in 2010 and are set to start falling off reports this year.   All of which, as the WSJ points out, will help to "boost originations of large-dollar loans for cars and homes."  Which is precisely what the average, massively-overlevered American household needs...more debt. Fresh starts for credit reports are likely to help boost originations of large-dollar loans for cars and homes. Consumers have a greater chance of getting approved for financing if they apply for loans after negative events fall off their reports, in particular from large banks that have stuck to strict underwriting criteria, says Morgan Whitacre, who oversees consumer-loan underwriting at Bank of America Corp.   Credit-card lending, already on the rise, could increase further as a result of fresh starts. Consumers who have one type of bankruptcy filing removed from their credit report experience a roughly $1,500 increase in spending limits and rack up $800 more in credit-card debt within three years, according to the Federal Reserve Bank of New York. So maybe that auto lending bubble has a little room left to run afterall...

29 мая, 17:21

Forex: мнение BofAML - события текущей недели будут важными для валютного рынка

Bank of America Merrill Lynch FX Strategy Research отмечает, что события этой недели будут играть важную роль для валютного рынка, так как инвесторы с большим оптимизмом смотрят на евро, в то время как настроения по отношению к доллару США остаются относительно неоднозначными. "Фокус рынка теперь смещается на предстоящие американские данные, в частности, базовый индекс цен расходов на личное потребление, индексы PMI от ISM и отчет по числу занятых вне сельского хозяйства. При вероятности повышения ставки в июне на уровне около 80%, любой комментарий чиновников ФРС будет тщательно проанализирован на предмет подсказок о том, что ФРС удовлетворяет текущая инфляционная ситуация. В целом, у ФРС есть только текущая неделя, чтобы ослабить ожидания рынка, если они этого захотят", - отмечает BofAML. "Между тем, приближается очередное заседание ЕЦБ, и мы ожидаем, что уже на июньской встрече увидим изменение тона заявлений на более "агрессивный". Также на этой неделе повышенное внимание привлекут данные по инфляции в еврозоне. Хотя текущее позиционирование не выглядит "растянутым" на более долгосрочную перспективу, стоит отметить, насколько резким было недавнее изменение позиции в евро, что предполагает некоторые риски тактических откатов", - добавляет BofAML. Стратегически BofAML остается медвежьим по отношению к иене, евро, и доллару, хотя отмечает, что краткосрочный прогноз по USD/JPY является более неопределенным. Информационно-аналитический отдел TeleTradeИсточник: FxTeam

29 мая, 15:07

Fosun International планирует приобрести активы Origin Energy

Согласно информации из осведомленных источников, китайский конгломерат Fosun International заинтересован в приобретении нефтегазовых активов австралийской фирмы Origin Energy. Сообщается, что стоимость соглашения может составить 2 млрд австралийских долларов ($1,5 млрд), а консультантами в рамках сделки выступают UBS, Macquarie и Bank of America Merrill Lynch. Стоит отметить, что компания Origin сообщила о том, что намерена отделить свой нефтегазовый бизнес в отдельное подразделение, которое получит название Lattice Energy, еще в декабре прошлого года. Известно, что в приобретении данного подразделения заинтересовано еще 4 компании.

29 мая, 13:03

Fosun International планирует приобрести активы Origin Energy

Согласно информации из осведомленных источников, китайский конгломерат Fosun International заинтересован в приобретении нефтегазовых активов австралийской фирмы Origin Energy. Сообщается, что стоимость соглашения может составить 2 млрд австралийских долларов ($1,5 млрд), а консультантами в рамках сделки выступают UBS, Macquarie и Bank of America Merrill Lynch. Стоит отметить, что компания Origin сообщила о том, что намерена отделить свой нефтегазовый бизнес в отдельное подразделение, которое получит название Lattice Energy, еще в декабре прошлого года. Известно, что в приобретении данного подразделения заинтересовано еще 4 компании.

29 мая, 09:39

Курс доллара США в понедельник растет относительно евро

Курс доллара США в понедельник повышается относительно евро и практически стабилен к японской нацвалюте.

29 мая, 08:21

Resistance раскрыла тайну империи Ротшильдов: три истинных владельца «Короны»

Французский сайт «Политическое сопротивление» раскрыл неизвестное ранее досье Ротшильдов, раскрывающее зависимость США от финансового центра в Лондоне, или «Короны». Последняя не имеет никакого отношения к монархии Виндзоров и королеве Англии, являясь государством в государстве. США являются частной корпорацией Лондонского Сити, основанной после открытия в 1913 году в Нью-Йорке Федеральной резервной системы.

29 мая, 07:55

Утренний обзор

Доброе утро! Аналитики Bank of America Merrill Lynch  присоединились к мнению большинства экспертов о том, что Федеральная резервная система повысит базовую процентную ставку на заседании 13-14 июня, пишет газета Financial Times. Тем не менее, в BofAML по-прежнему полагают, что статданные по экономике США не оправдывают подъем ставки на июньском заседании. Планы подъема ставки Федрезервом поддерживают благоприятные финансовые условия — рост фондового рынка США и ослабление доллара, а также желание сдвинуться с мертвой точки в плане нормализации кредитно-денежной политики, отмечают эксперты BofAML. В пятницу министерство торговли США пересмотрело в сторону повышения оценку роста американской экономики в первом квартале 2017 года. ВВП США в минувшем квартале увеличился на 1,2% в пересчете на годовые темпы, свидетельствуют пересмотренные данные Минторга. Предварительная оценка равнялась 0,7%. Подъем американской экономики в январе-марте замедлился по сравнению с 2,1% в четвертом квартале прошлого года. Руководство ФРС также продолжило обсуждение планов сокращения объема активов на балансе в ходе майского заседания, говорилось в протоколе. Серьезные неприятные сюрпризы в статданные в следующие две недели могут усложнить принятие решения по ставке Федрезервом на июньском заседании". Эксперты отмечают, что наиболее важным является показатель PCE Core (Personal Consumption Expenditures, Excluding Food & Energy), на который обращает внимание ФРС при оценке рисков инфляции. Данные о динамике этого показателя будут опубликованы в отчете о доходах и расходах американцев за апрель 30 мая. Среди других важных данных — отчет о продажах автомобилей в США за май (1 июня), майский отчет о безработице (2 июня), а также данные о динамике розничных продаж и инфляции (14 июня). Согласно данным CME FedWatch, вероятность подъема ставки американским ЦБ на июньском заседании оценивается рынком более чем в 80%. В понедельник американские биржи будут закрыты в связи с Днем памяти. Индексный провайдер MSCI заменил в топ-4 индекса MSCI Russia 10/40 глобальные депозитарные расписки  «НОВАТЭКа» на GDR «Магнита» по итогам майской ребалансировки. Среди значительных изменений весов в индексе MSCI Russia 10/40 отмечено понижение веса акций «Интер РАО» ,  GDR «ФосАгро», акций «РусГидро» ,  а также акций «Ростелекома» .  При этом вес акций «Газпрома»  повышен на 62 базисных пункта — до 9,13%. Все изменения вступят в силу 31 мая после закрытия торгов. Индексы MSCI носят прикладной характер: многие инвестиционные фонды их «покупают», то есть вкладываются в акции, входящие в структуру индекса, пропорционально весу в нем, а также разрабатывают сложные структурные инструменты на основе индексов. Включение в индекс MSCI гарантирует акциям компаний более высокую ликвидность. Распределение весов в индексе MSCI Russia 10/40 важно с точки зрения активов фондов, вкладывающих средства в Россию, так как многие из них обязаны следовать директивам UCITS III, которые, в частности, предполагают запрет на аллокацию более 10% активов в акции одной компании. Ну и на злобу дня, т.к тема криптовалют в последнее время активно обсуждалась на СЛ. Греф призвал как можно скорее легализовать хождение криптовалют в РФ . Хождение криптовалют в РФ нужно легализовать как можно скорее, в ЦБ идет достаточно конструктивный диалог в этой сфере, считает глава Сбербанка. В четверг зампред ЦБ Ольга Скоробогатова сообщила, что Банк России через месяц представит вариант нормативных документов по налогообложению криптовалют, в том числе биткоина, как цифрового товара. «Мне кажется, в новых технологиях попытка действовать запретами приводит к тому, что мы начинаем очень сильно проигрывать конкурентам», — сказал Греф. «Вся эта история с биткоином как центральному банкиру, бывшему и настоящему, мне не нравится. Это некий заместитель денег, некий суррогат. Как с этим быть, не знаю. Это такая тяжелая длинная история, ответа пока не знаю», — парировал экс-председатель ЦБ Сергей Игнатьев, возглавляющий набсовет Сбербанка. Сейчас в РФ действует запрет на выпуск денежных суррогатов, однако ответственность за несоблюдение этого запрета не установлена. Минфин готовил законопроект о криптовалютах, который, в частности, должен был ввести уголовную ответственность за их использование. Однако позже власти РФ решили отказаться от столь жестких мер. Индекс ММВБ закончил торги пятницы  на локальной поддержке 1934п и при продолжении негативной динамики следующие поддержки расположены в районе 1915 и 1900п. Зона покупок — смены тенденции находится при закреплении над 1965п. фРТС первое сопротивление на пути к росту расположено на отметке 108000п, зона покупок над 108500 ( будет уточняться по ходу торгов). Основной поддержкой удерживающей фьючерс от падения в район 103000 является 105400п. Для регулярного выхода утреннего обзора ставьте пожалуйста плюсы.

Выбор редакции
28 мая, 22:21

Where Would Apple And Google Rank In Terms Of World's Richest Countries?

Maybe the Occupy Wall Street movement was looking to the wrong coast all along. A recent Bank of America Corp (NYSE: BAC )/Merrill Lynch report titled " Occupy Silicon Valley " shows that tech ...

Выбор редакции
Выбор редакции
28 мая, 05:00

Visualizing The Expanding Universe Of Cryptocurrencies

Bitcoin is the original cryptocurrency, and its meteoric rise has made it a mainstay of conversation for investors, media, and technologists alike. In fact, as Visual Capitalist's Jeff Desjardins details, the innovation of the blockchain is changing entire markets, while causing ripples with central banks and the financial industry. At time of publication, the bitcoin price now hovers near US$2,200, a massive increase from this time last year. But the true impact of Bitcoin is actually far more reaching than this – it’s actually helped to birth new markets for over 800 other cryptocurrencies and assets that are available for online trading. And while the market for bitcoins is worth nearly $40 billion itself, the rest of these cryptocurrencies are actually worth even more in combination. Courtesy of: Visual Capitalist   THE ALTCOIN UNIVERSE For the first time since Bitcoin was founded, it now makes up the minority of the entire cryptocurrency market at about 47.9% of all coins and assets. So what are the other altcoins that make up the rest of this universe, and where did they come from? Litecoin Litecoin is one of the first altcoins, and it is nearly identical to Bitcoin after being “forked” in 2011. Litecoin aims to process blocks 4x faster than Bitcoin to speed up transaction confirmation time, though this creates several other challenges as well. At time of writing, Litecoin’s market capitalization is worth $1.3 billion. Ethereum Ethereum, launched in 2015, is the largest coin by market capitalization aside from Bitcoin. However, it is also quite different. While Bitcoin is designed to be a payments protocol first, Ethereum enables developers to build and deploy decentralized applications, while also enabling smart contracts. The tokens used to power the network are called Ether, but they can also be traded online. At time of writing, Ethereum’s market capitalization is $15.4 billion. Also interesting: the Ethereum network actually split into two in 2016. It’s a complicated situation, but read about it here. There is now a separate Ethereum, based on the original Ethereum blockchain, trading as “Ethereum Classic” with its own market capitalization of $1.4 billion. Ripple Ripple (XRP) is the native currency of the Ripple Protocol – a broader catch-all for an open-source, global exchange. It’s already being used by banks such as Santander, Bank of America Merrill Lynch, UBS, and RBC. It solves a different problem than Bitcoin, allowing for settling payments between different currencies and even different payment systems. Today, Ripple’s native coin (XRP) has a market cap of $10.9 billion. LEARN MORE With over 800+ altcoins or assets out there, there’s plenty of information to absorb. Here’s a short 20-minute course on the history of altcoins that might provide useful context, as well as in-depth explanations of Ethereum and Ripple that may help you learn about the important parts of a rapidly growing altcoin universe.

27 мая, 16:30

Мистика какая-то. Число, правящее миром

В культовом романе "Путеводитель для путешествующих автостопом по Галактике" даётся ответ на "главный вопрос жизни, Вселенной и всего такого" (англ. The Ultimate Question of Life, the Universe and Everything). Этот ответ должен был решить все существующие в мире насущные проблемы. Специально созданный мощнейший во Вселенной суперкомпьютер искал его в процессе семи с половиной миллионов лет непрерывных вычислений, и его ждали все разумные расы. Когда этот ответ был наконец получен, он гласил: "42". Действительно ли это число столь важно, могущественно и загадочно, или же это всего лишь досужие измышления писателя-фантаста? Не будем слушать шарлатанов от нумерологии, а обратимся к неопровержимым фактам, которыми пронизана вся наша жизнь. Начнём со Вселенной. Голландский астроном Йорг Рахен (Jorg Rachen), участвующий в проекте космической обсерватории "Планк", и немецкий философ Уте Гахлингс (Ute Gahlings) опубликовали работу, в которой указывается, что основные параметры стандартной космологической модели могут быть получены из комбинирования всего лишь трёх чисел: 23, 42 и числа Пи. Авторы сформулировали концепцию, которую назвали конспирологической космологией, поскольку выявленные ими закономерности натолкнули их на мысль, что основные параметры нашей Вселенной не случайны, а заданы некими высшими силами, причастными к её созданию. Строго говоря, современная астрофизика достаточно уверенно прослеживает историю Вселенной практически до самого момента Большого взрыва, давшего ей начало. Однако что было до этого (если, конечно, можно употребить термин "до этого", ибо время как таковое в нашем понимании тогда не существовало), мы не знаем. И у нас попросту нет ни физических, ни методологических инструментов это узнать. Более того, физика и астрофизика способны ответить на вопрос "Как?". С вопросом "Почему?" — намного сложнее. Почему такие фундаментальные константы, как постоянная Планка или заряд электрона, имеют именно такие, а не другие значения? Почему скорость света в пустоте составляет именно 300 тыс. км/с? В космологии существует т.н. антропный принцип, в соответствии с которым бессмысленно искать объяснения некоторым особенностям наблюдаемой нами Вселенной; они именно таковы просто потому, что нас угораздило появиться именно во Вселенной как раз с такими свойствами. А других вселенных с другими характеристиками мы попросту не видим (необходимо сказать, что в последние два десятилетия появилось достаточно много теоретических работ, на полном серьёзе исследующих возможность множественности вселенных). Что же до вопроса "Зачем?", то никакие естественные науки в принципе не способны дать на него ответа, — он относится к компетенции философии. Зачем была создана Вселенная, если она была создана? У разных философов и теологов есть множество вариантов ответа. Меж тем никакие известные на сегодняшний день науке факты совершенно не противоречат гипотезе, будто она была создана в результате целенаправленного акта творения, хотя нет и доказательств обратного. Знаменитый британский астрофизик Стивен Хокинг, много лет прикованный к инвалидному креслу, в настоящее время работает над созданием всеобъемлющей "М-теории", или "Теории всего", призванной заполнить пробелы, оставленные теорией суперструн и общей теорией относительности Эйнштейна. В своё время Хокинг пришёл к выводу, что для запуска процесса формирования нашей Вселенной Бог (или какая-то всемогущая, по нашим меркам, разумная сила, которую мы могли бы так называть) совершенно не обязателен. Тем не менее недавно Bank of America Merrill Lynch в информационной записке для своих клиентов выдвинул теорию, будто с вероятностью от 20% до 50% вся наша Вселенная и человечество в частности являются объектом компьютерного моделирования, т.е. существуют в своеобразной матрице, и это не было первоапрельской шуткой. Илон Маск более категоричен: согласно его точке зрения, шанс на то, что мы существуем в объективной реальности, не превышает одного на несколько миллиардов. Итак, в чём состоит "конспирологическая космогония" Рахена и Гахлингса? Авторы начинают с определения набора основных конспирологических постоянных. В первую очередь они выделяют число 23, равное сумме трёх последовательных простых чисел: 5+7+11. Кроме того, это единственное целое число, которое находится в интервале от Пи в степени e (~22.4) до e в степени Пи (~23.1). Следующее выделяемое ими число — 42. Если записать его в двоичной системе счисления, то получится 101010 — пара 10 три раза, — что ведёт к числу 23. Комбинируя эти два числа с числом Пи, оказывается, можно получить набор основных параметров современной космологической модели. Например, доля барионного вещества во Вселенной — 42/1000 от общего количества материи. Значение постоянной Хаббла, характеризующей скорость расширения Вселенной H0=72 (км/c)/Мпк, почти равно 23*Пи. Доля тёмной материи — 23 процента, а доля загадочной тёмной энергии — 72 процента от всей гравитационной энергии Вселенной, что опять же равно 23*Пи. Произведение 23*42=966, названное авторами суперконспирологической постоянной, явно соответствует величине 0,966, близкой к показателю спектра первоначальных возмущений плотности материи, которая, как показали результаты миссии "Планк", несколько отличается от единицы. Авторы приходят к выводу, что такого рода совпадения вряд ли являются случайными и что либо наша Вселенная была создана некоей разумной силой, либо Вселенной в обычном понимании этого слова вообще не существует и весь мир не более чем иллюзия. Например, компьютерная программа, созданная для каких-то особых целей, известных только её создателям, которых авторы именуют ёмким словом "они". Что вполне совпадает с предупреждением Bank of America Merrill Lynch и точкой зрения Илона Маска. Если предположить на минуту, будто теория Рахена и Гахлингса верна, смысл ответа, так и не понятого персонажами Дугласа Адамса, становится яснее. Ведь число 42 — основная константа, заложенная в структуру нашей Вселенной её гипотетическими создателями. При таком подходе уже не удивляют чрезмерно частые, с точки зрения теории вероятности, случаи, когда это число играет значительную роль в нашей жизни и смерти, а то и в судьбах всего мира. Ведь теория вероятности исследует случайные события, а это число было заложено в ткань мироздания, что называется, "по дизайну". Радуга появляется, когда свет преломляется и возвращается к наблюдателю под углом в 42 градуса. Дуга радуги имеет радиус 42 градуса. При высоте Солнца в 42 градуса радуга исчезает. Большая туманность Ориона — ярчайший диффузный объект, видимый на небе невооружённым глазом, известный со времён античности и весьма сильно стимулировавший в своё время развитие астрономии. Французский астроном XVII века Шарль Мессье, создавший первый в истории каталог туманностей и присвоивший ей номер 42, отметим, явно ничего не знал о теории Рахена и Гахлингса. TTTAATTGAAAGAAGTTAATTGAATGAAAATGATCAACTAAG — именно так выглядит общая для всех позвоночных последовательность ДНК. В этой записи 42 символа. На всех ртутных медицинских термометрах отметка "42" обозначена красным цветом. Именно при этой температуре сворачивается белок крови и человек умирает. От естествознания перейдём к теологии и философии. Особое значение числа 42 можно разглядеть по тому, как часто оно фигурирует во всех религиях и насколько серьёзную роль в них играет.  Древние египтяне связывали с жизнью бога Осириса два числа — 28 (количество дней в лунном месяце) и 14 (по преданию, тело Осириса было расчленено на 14 частей, что является аллегорией, отражающей убывание луны от полнолуния к новолунию за 14 дней). В сумме эти два числа дают 42. В египетской Книге мёртвых сказано: на смертном суде люди ответят за свои 42 смертных греха перед 42 богами. Молитва "Ана бе коах" состоит из семи строк, а в каждой строке находится по шесть слов. Если сложить первые буквы всех этих слов, то получится имя бога. Изучать каббалу разрешается только по достижении 42 лет. Прежде чем удалиться в нирвану, Будда 42 года отвечал на вопросы. Согласно Священному Писанию, до рокового поцелуя в Гефсиманском саду Иисус проповедовал три с половиной года, то есть 42 месяца. А в роду у него было: "Всех родов от Авраама до Давида четырнадцать родов; и от Давида до переселения в Вавилон четырнадцать родов; и от переселения в Вавилон до Христа четырнадцать родов" (Матфей 1:17). Три раза по четырнадцать — это 42 рода. Первая в истории печатная книга — Библия Гутенберга — на каждой странице содержит ровно по 42 строки. Судьбы правителей, война и мир, как выясняется, также тесно связаны с этим числом. Гитлер, несомненно, являлся одним из самых ненавидимых персонажей во всей истории. До того момента, когда ведущая бои за Берлин Советская армия довела-таки его до самоубийства, на Гитлера было совершено в общей сложности 42 неудачных покушения. В стане же победителей после начала холодной войны и ряда первых ядерных испытаний в центре Москвы, под Таганским холмом, было сооружено стратегическое противоатомное убежище, предназначенное для первых лиц государства. Его местоположение было выбрано так, чтобы в случае объявления тревоги руководство СССР успело добраться и продолжить руководство армией и государством в условиях ядерной войны. Приказ о создании бункера был подписан лично И.В. Сталиным, а сам объект получил обозначение ГО-42 (сейчас там находится популярный музей, открытый для экскурсионных посещений). Архитектор набирающего сейчас обороты мирового кризиса, главный проводник идей глобализации и человек, запустивший по всему миру череду "гуманитарных бомбардировок" и "насильственного установления демократии", Билл Клинтон был 42-м губернатором штата Аризона и 42-м президентом США. Московские события октября 1993 г., когда Борис Ельцин расстрелял из танков здание Верховного Совета РСФСР и фактически произвёл антиконституционный государственный переворот, положили начало печально известным "лихим 90-м" — олигархическим и бандитским. Идеологические контуры этого пути развития страны были обозначены в обращении либеральных деятелей культуры, опубликованном в газете "Известия". Это обращение известно как "Письмо 42" — по числу подписавших его литераторов. Впрочем, подобных фактов при желании можно найти ещё великое множество. Гораздо интереснее посмотреть на то, как это число вплетается в ткань простых человеческих судеб, порой это производит совершенно ошеломляющее впечатление.  На 42-й минуте всенародно любимого фильма "Белое солнце пустыни", когда красноармеец товарищ Сухов и Петруха закладывают динамит на баркасе и испытывают бикфордов шнур, происходит такой диалог: П.: Загорится? С.: Должна. Как займётся, считай. П.: (Считает, пока горит шнур.) Сорок два! Теперь пускай плывут на катере, хе-хе, за кордон собрались. Заведут мотор и через 42 ка-а-а-ак! С.: Эт точно. Что происходит дальше по сюжету — все знают. Таможенник Верещагин — тот самый, которому "За державу обидно!" — захватывает баркас, заводит двигатель и направляется к берегу, к ним на помощь. Баркас взрывается, Верещагин гибнет. ...Через год после выхода фильма на экраны исполнитель роли Верещагина Павел Луспекаев умер от диабета в возрасте 42 лет. И, кстати, слово "смерть" в японском языке звучит точно так же, как число 42. Между тем творческая интеллигенция по всему миру уже давно использует число 42; если им нужно какое-то число, почему бы не использовать именно это? Своего рода всемирный флешмоб. Например, агент Малдер из сериала "Секретные материалы" живёт в квартире № 42, название одной из серий научно-фантастического сериала "Доктор Кто" — "42", мистические числа в сериале "Остаться в живых" — 4, 8, 15, 16, 23, 42 (23 и 42 в конце!), номер поезда в фильме-катастрофе "Метро" — снова 42. А скоро в России даже будет снят фильм, который так и называется — "42". Герой фильма увлекается коллекционированием этого числа, а в итоге разгадывает его настоящий секрет. Впрочем, является ли этот секрет действительно настоящим, неизвестно.

26 мая, 21:47

Global Payments (GPN) to Provide Samsung Pay in Hong Kong

Global Payments Inc. (GPN) has announced that it will provide its merchants the facility to pay via Samsung Pay in Hong Kong.

26 мая, 19:46

Short on Alfa

Ravenous investors are devouring fintech’s IPO scraps. Financial software group Alfa is floating in the biggest UK offering this year by company value. The pricing looked rich to start with,

26 мая, 19:30

70% Of Millennials Have Less Than $1,000 Saved For Buying A House

One of the frequent reasons cited for the failure of the US housing sector to rebound to its pre-recession levels, is the lack of household formation among young American adults and specifically the unwillingness, or inability, of Millennials, which last year overtook Baby Boomers as America's largest generation... ... to move out of their parents' basement, or stop renting, and purchase their own home. Now, a new study from Apartment List confirms the underlying problem: nearly 70% of young American adults, those aged 18 to 34 years old, said they have saved less than $1,000 for a down payment. This is similar to what a recent GoBanking Survey found last year, according to which 72% of "young millennials"- those between 18 and 24 years old - had $1,000 in their savings accounts and 31% have $0; a sliver (8%) have over $10,000 saved. Of the "older millennials", those between 25 and 34, 67% had less than $1,000 in their savings accounts, 33% have nothing at all, and 15% have over $10,000. As the WSJ frames it, with most millennials having saved virtually nothing for a down payment on a home "many will face steep obstacles to homeownership in the years ahead." It also means that the US housing market, traditionally the bedrock of middle-class American wealth, may never recover to levels seen during the prior economic cycle which incidentally peaked as the housing bubble burst, scarring an entire generation with the vivid memories of what happens when millions of Americans rush to overpay for homes. Which is not to say that US housing is languishing, on the contrary. As we showed earlier this week, in the first quarter of 2017, the number of California homes that sold for $1 million or more totaled 10,562 up 11.7% year over year and the highest on record for a first quarter. However, while the 1% (or even 10%) of America's wealthiest buy and sell trophy real estate among each other (or to Chinese oligarchs) with impunity, creating another bubble in luxury real estate, for the vast majority of America, it's "middle class", homeownership is becoming an increasingly elusive dream, forcing many to contend with renting indefinitely. And, going back to the original study, the culprit appears to be the inability, or unwillingness, or America's youth to save because according to Apartment List, even senior members of the age group are falling short. Nearly 40% of older millennials, those age 25 to 34, who by historical measures should already own or be a few years away from homeownership, said they are saving nothing for a down payment each month. Here is the punchline: the vast majority—some 80%—of millennials said they eventually plan to buy a home. But 72% said the primary obstacle is that they can’t afford it. That's a pretty big obstacle as the study's creator admitted. “It’s encouraging that millennials do want to buy homes. It suggests that they are delaying forming households but they’re not giving it up,” said Andrew Woo, director of data science and growth at Apartment List. “The biggest reason [they aren’t buying] is because of affordability.” This is how America's most troubled generation sees the problem in their own words: Catie Peterson, a 22-year-old graphic designer in Fort Lauderdale, Fla., said she doesn’t expect to start saving for a down payment for another five years or so. “I barely have enough savings to cover my car if it were to break down,” she said. Peterson said she pays $975 a month in rent for a small one-bedroom apartment, which is about one third of her paycheck, leaving little room to save. “Once I get settled in my career and settled in my family, I think buying a house would be reasonable.” It would, but good luck finding something that is affordable enough for the bank to give you a mortgage. As for the main reasons cited by Millennials why they are unable to save any money, these should be familiar to regular readers: they include student loan debt, rising rents and the slow starts many got to their careers during the recession. Furthermore, with many living in vibrant urban centers with ready access to restaurants, bars and entertainment might, saving seems less urgent. Furthermore, many are children of the affluent baby boomer generation and some expect their parents to give them a boost when the time comes, i.e., they expect to inherit their parents wealth. In total, some 25% of millennials ages 25 to 34 expect to receive help from friends or family, according to the survey. Still, three-quarters said they expect to receive less than $10,000, which might not be enough to close the gap. * * * It was not all bad news: the study found that some young people, if not nearly enough, may be saving more. On average, millennials who make more money save a smaller share of their incomes. Those making less than $24,000 save about 10% of their incomes, for example, while those making more than $72,000 save just 3.5%, according to the survey. Also, more millennials are finding a way to buy homes than a few years ago. First-time buyers have accounted for 42% of buyers this year, up from 38% in 2015 and 31% at the lowest point during the recent housing cycle in 2011, according to Fannie Mae (still, a first-time buyer is anyone who hasn’t owned a home in the past three years, a group that could include older people as well.) Unfortunately for the generation that represents America's future, the bad news dominates, and as the WSJ concludes many millennials face daunting odds: "less than 30% of 25- to 34-year-olds can save enough for a 10% down payment in the next three years, while just 15% could save that much within a year, according to the Apartment List survey." Of course, there is a loophole. As we reported last week, programs are being rolled out to allow first-time buyers to purchase homes with even smaller down payments.  In fact, none other than the bank which had to be bailed out less than a decade ago, Bank of America, recently announced intentions to slash down payments to help Millennials. Speaking to CNBC, BofA CEO Brian Moynihan, the proud owner of Countrywide Financial, said that his mission is to reduce mortgage down payment requirements to 10% for traditional loans.  Per CNBC: "But, you know, I think at the end of the day is people forget that, at different points in your life and different points on what you're doing in life requires you to think about housing differently as a place for you and your friends, as a place for you and maybe your significant other, and then ultimately, a place for family. That drives change. And so yes, it's taken more time. And we talked a lot about this, you know, four or five years ago, that if you require a 20% down payment, it takes just a little more time to accumulate 20% than it would 3% or none, which is what the rules were for a short period of time." "So our goal, going back to regulatory reform, is should you move the down payment requirement from 20% to 10%? Wouldn't introduce that much risk." Of course, as we pointed out last week, we are certain that Moynihan's sole purpose for wanting to lower down payments is to help those poor millennials living in mom's basement, and has nothing to do with the fact that's Bank of America (and Wells Fargo) has lost a ton of fee revenue to government-backed loans that only require a 3% down payment. Why not?  Gradually destroying lending standards worked out really well last time around. But we digress, so here is 33-year-old data analyst Gina Fontana who explained her problem so simply, even a Fed president could get it: she said she has saved a bit for a down payment but doubts she will use it anytime soon because home prices are so far out of reach. She added that she had saved enough for a 10% down payment on a $200,000 house when she was living in Philadelphia, but couldn’t buy anything in the neighborhoods she liked. Now she has moved to Berkeley, Calif., and said the area’s home prices—where starter homes can go for close to $1 million—make the odds of buying a home essentially zero. “I don’t see that ever happening,” she said. “I just prefer to travel.” Which is why it is only a matter of time before everyone throws in the towel on the housing recovery, and Goldman launches its first millennial travel-collaterialized securitization product (and its synthetic derivative).

26 мая, 15:16

В технологическом секторе надувается новый пузырь

С момента выборов в США ни один сектор фондового рынка не пользовался такой популярностью у инвесторов, как технологический, пишет Business Insider.

26 мая, 15:16

В технологическом секторе надувается новый пузырь

С момента выборов в США ни один сектор фондового рынка не пользовался такой популярностью у инвесторов, как технологический, пишет Business Insider.

Выбор редакции
26 мая, 09:00

A New Financial System Is Being Born

Authored by Mike Krieger via Liberty Blitzkrieg blog, If Bitcoin blew you away when you first discovered it, and continues to do so to this day, Spiral Dynamics can help explain why. Bitcoin was an expression in the physical world of the newly emergent leading-edge integral level consciousness. It drew lessons from history and attempted to take the best of orange and green worldviews and incorporate them into an entirely new form of money. We see the clear presence of free markets and individualism, as well as the intentional separation of the system from dominator hierarchies (bureaucratic government meddling), which had corrupted all money before it. Its greenness is evident in the fact that by design no individual or company controls the network. Global, decentralized, revolutionary technology. This is perhaps the perfect example of integral consciousness operating on our planet at this time from an economics standpoint, and why it has captured the imagination of so many, while at the same time being violently rejected by so many others.   From February’s post: Why Increased Consciousness is the Only Path Forward Although I had heard about it much earlier, I didn’t truly start investigating Bitcoin until the summer of 2012. The more I learned the more my mind was blown away, and for a while I couldn’t think about anything else. What truly solidified its real world usefulness to me was when I discovered it had been used by Wikileaks to accept payments in the midst of a financial services blockade against the renegade publisher. This realization inspired my first Bitcoin related post in August 2012 titled, Bitcoin: A Way to Fight Back Against the Financial Terrorists?  In that piece, I linked to a Forbes article that detailed the revolutionary events taking place. We learned: Following a massive release of secret U.S. diplomatic cables in November 2010, donations to WikiLeaks were blocked by Bank of America, VISA, MasterCard, PayPal and Western Union on December 7th, 2010. Although private companies certainly have a right to select which transactions to process or not, the political environment produced less than a fair and objective decision. It was coordinated pressure exerted in a politicized climate by the U.S. government and it won’t be the last time that we see this type of pressure.   Fortunately, there is way around this and other financial blockades with a global payment method immune to political pressure and monetary censorship.   On its public bitcoin address, Wikileaks has taken in over $32,000 equivalent in more than 1,100 separate bitcoin donations throughout the blockade (1BTC = $10.00). But these amounts may be significantly higher, because it does not even include the individually-generated bitcoin addresses that WikiLeaks provides for donors upon request. I knew right then and there that Bitcoin had the potential to change the world. My passion for Bitcoin was always framed by my ten years working in the financial industry. Many of us who lived through the 2008 crisis knew the financial system was dead. We knew it was corrupt, archaic and terminal, so many of us began bracing for what might come next. We did what we thought made sense at the time, which included buying precious metals like gold and silver given their historic track record of protecting wealth in periods of paradigm-shifting financial disruption. Others took more extreme measures to protect themselves from the end of the financial system, but a small group forward thinking geeks decided to do something much better. They decided to build an alternative. Thus, Bitcoin was born and early adopters in the field of technology immediately began to build on top of it. As soon as I realized what was happening much of the “doom and gloom” that had enveloped my thinking began to lift. I now knew that even if the financial system crashed and burned tomorrow, the early stages of a new and far more honest financial system were already in place. The emergence of Bitcoin literally changed my life for the better as it allowed me to emerge from a cave of gloom and become optimistic about our long-term future. While I knew the path would be long and hard since the current entrenched interests wouldn’t give up without a fight, I could see a very bright light at the end of the tunnel, and the continued development in this space has been extraordinary to watch ever since. The global financial system as it stands completely archaic and corrupt. It enriches the wrong types of people for the wrong sort of behavior, and is entirely extractive and parasitic by design.  If there’s sector in the economy that needs a total redesign and reboot for the sake of humanity, it’s the financial system. Being involved in the crypto world for the past five years has been a breath of fresh air and a shot of adrenaline to my system. Traditional markets are a rigged snooze-fest by comparison, grotesque financial Potemkin villages designed to make overly indebted, predatory economies look good. What I find so fascinating about the current environment is that many of the dreams we all read about in the very early days of Bitcoin are starting to be implemented and designed, slowly but surely. For those of you who still have a difficult time conceptualizing exactly what’s happening in the space, I think the following tweet may help. If you think of the crypto coin world as the beginning of an entirely new financial system architecture it all makes a lot more sense. — Michael Krieger (@LibertyBlitz) May 24, 2017 On that note, I want to talk about more than just Bitcoin, which I see as the reserve currency of the crypto world. Beyond Bitcoin, a lot of the buzz in the space right now revolves around a burgeoning phenomenon known as ICOs, or Initial Coin Offerings. So what are ICOs? Yesterday, TechCrunch published an interesting piece on the topic. Here are a few keys points:   Because this editor was still confused (I’m not proud), I talked yesterday with Stan Miroshnik, a UC Berkeley grad with an MBA from MIT who today runs L.A.-based Argon Group, one of the first digital finance-focused investment banks. Miroshnik nicely answered an array of questions about ICOs, including how these things get staged, how companies establish a value for their offerings, and more. If you’re still trying to get a handle of this latest investing trend, too, read on.   TC: ICOs are everywhere suddenly.  When was the first ICO staged?   SM:  You have to go back to around 2013, when Mastercoin, a protocol on top the bitcoin blockchain, raised $500,000. Then you had a number of other milestone token sales, such as Ethereum in 2014, then the DAO, or Decentralized Autonomous Organization, which was built on the Ethereum blockchain and that stored and transmitted Ether and Ethereum-based assets and that raised the equivalent of $150 million last year.   Momentum began to build after that, as a smaller group of [these offerings] grew in size, and by last fall, some companies were raising millions of dollars in minutes. That really kind of made people stand up and wonder if this is a new funding mechanism. TC: How many ICOs have there been to date?   SM: There were 64 last year that collectively raised $103 million, excluding the DAO. So far this year, we’ve seen 25 offerings raise a bit more than $163 million, and we’re on track to see more than $210 million raised by the end of June.   TC: So how do these ICOs work, practically speaking?   SM: There’s a cadence to these things. You do the prep-work and get your project to a natural technical milestone. Then you pre-announce when you’re planning to have a token sale, describing some of the terms, and telling a story of the project and its goals. You publish a white paper and disclosure and give people a chance to read it and comment. There are also usually threads that develop on Reddit, Bitcointalk, Slack, Telegram and elsewhere, where people actively debate the merits of the product. Then, on the landing page on the aforementioned date, there’s typically a tool that enables purchasers to acquire the tokens in exchange for bitcoin or ether.   TC: Is there a concern that U.S. regulators will crack down on these ICOs?   SM: Lawyers are relying on case law that defines what a security is. The most well-known case is the “Howey Test,” created by the Supreme Court for determining whether certain transactions qualify as investment contracts. If they do, then those transactions are considered securities and are subject to certain disclosure and registration requirements. When tokens are structured basically as the sale of a service or product, they’re designed to make sure the various prongs of the test are not triggered.   TC: What types of companies are primarily using ICOs?   SM: It’s still a financing mechanism that’s very organic to the blockchain community.   It all started with protocols like Ethereum raising funding through this mechanism, and it has stayed close to related projects, like the distributed storage company Storj and Civic, a company that provides identify through the blockchain and is announcing its token sale this Thursday. A lot of these founders and token buyers are part of bitcoin forums and Reddit, and that’s why [certain companies] are able to raise these large sums fairly quickly; they’re reaching out to thought leaders and getting their support and generating buzz about their projects. It’s  basically the open source community, now with an open-source funding mechanism.   TC: What happens when people want to sell the tokens they’ve bought?   SM: Well, first, you can use them in a company’s ecosystem. With Storj, maybe you buy storage. You can also accumulate these tokens over time, as a bet that with more enterprise demand for storage capacity, the coins will become more valuable, after which you can sell your tokens to someone else who needs to purchase storage space. There are also a number of cryptocurrency exchanges where these tokens trade. In the case of Storj, you can sell or buy on Poloniex or Bittrex.   TC: Should VCs be nervous about ICOs? You mention Civic, which is staging an ICO. Civic has also raised some venture capital previously. But plenty of other companies seem to be skipping the VC part.   SM: To some degree they should, but we’ve also talked with a lot of very smart VCs who are looking at this space, including August Capital, Tim and Adam Draper, Blockchain Capital. Many are doing the work to understand how to be involved and active in the space and the fundamental value of these protocols. Union Square Ventures has said it now has a mandate from its LPs to hold these assets.   For companies that raise funds through a token sale and that have had traditional angel or venture rounds previously, for example, their equity investors get to skip one or two rounds of dilution, which is great; it means their returns are hyper-levered. There are two points I want to emphasize from the above. First, just how early we are in the development of this area. The numbers are absolutely tiny at this point despite all the hype. Recall that in 2017, we’ve seen 25 offerings raise a bit more than $163 million. That’s an infinitesimally small number in the scheme of things, thus room for growth is massive. That being said, people considering getting involved in this space as a buyer of ICOs need to be extraordinarily careful. Investing in general is risky and challenging, but putting money into an ICO adds several other layers of complexity and risk. First, as noted above these things are not equity investments since they aren’t allowed to be under current regulations. Therefore, you’re not simply investing in a startup, which is always extremely risky, but you’re making a bet that the token itself is useful and will accrue in value over time. Therefore, not only do you need to be right about the success of the business or product itself, but the token also must have a real value-creating purpose to succeed in the long-run. Many people will not understand this and think they are buying into the equity of the underlying businesses, which sets up a perfect environment for fraudsters. You also need to bear in minds there’s a ton of Bitcoin liquidity that is flooding around the space given the massive run its had. Most early Bitcoin adopters and investors are very passionate and dedicated to this space. They don’t want to sell coin for dollars, but want to put it in new projects to keep the broader ecosystem growing. I think this is a fantastic thing, but it also means there’s a lot of crypto currency sloshing around trying to find a home. Despite the risks, I think the emergence of the burgeoning token market is a game-changing and extraordinarily empowering development. The only thing preventing the crypto-coin world from rapidly displacing the middlemen and bureaucrats of the traditional financial system are the barriers around the traditional financial world. While we’d like to think these barriers are there to protect the little people, we all know that the SEC and other such regulatory bodies largely exist to protect the rich and powerful and secure their moat. We saw this under Obama’s Mary Jo White, and we will surely see it under Trump’s pick Jay Clayton, who seems to have all sorts of conflicts, including a wife who works at Goldman Sachs. The SEC doesn’t protect the people, but as long as it pretends to, it can continue to function as a gatekeeper for financial oligarchs and slow down the pace of displacement of the dying financial system with the new parallel one currently being created. All of that is fine I suppose, and innovation in the crypto world will continue until one day we will actually see equity offerings in startups to regular people as opposed to just allocations to the wealthiest clients of brokerage firms. The innovation in this space has the potential to flatten the world of investing in a meaningful and powerful way, starting today with tokens, but ultimately in many other ways as well. It’s gonna take time, but it’ll happen. At this point, I just want to briefly address the common retort that “governments will never let this happen,” which I get all the time. Here’s what I had to say about it yesterday on Twitter, and I don’t really have much to say beyond this. To conclude, I’d like to dedicate this post to all the brilliant geeks and the dynamic entrepreneurs pushing hard every day to realize this incredible dream of a decentralized future. A future that breaks down barriers, removes middlemen and empowers humanity to take its next evolutionary leap forward. You are the ones creating this brand new world brimming with potential and optimism, and I want to thank for all you have done and continue to do.

Выбор редакции
25 мая, 18:03

What Keeps Bank of America Up At Night

It has been a painful, bruising intellectual exercise for BofA's HY credit strategist Michael Contopoulos, who after starting off 2016 uber-bearish, was - together with every other money manager and advisor - taken to the woodshed, and forced to flip bullish, kicking and screaming, and advising BofA clients to buy the same junk bonds he told them to sell just a few months prior. Now, thanks to Trump, he may be finally seeing a glimmer of the bearish light returning, and in a note published this morning, Contopoulos asks whether the US is looking at a replay of 2014 and 2015, when as a reminder, a false dawn turned out to be an ugly dusk, and forced first the BOJ, then the ECB to intervene aggressively with even more QEasing. As BofA admits, "the last two weeks have further underpinned our belief that the market has had misplaced optimism in the new administration's reform agenda, while we find more and more evidence that suggests the macro environment echoes that of 2014 and 2015. Meanwhile, the market environment has closely tracked that of late 2013 and early 2014, when expectations for higher rates, low defaults and strong fundamentals caused a bid for risk that sent yields to sub-5% until geopolitical risks shocked investors (a plane being shot down over Ukraine). Once cracks were exposed in 2014, and illiquidity concerns replaced a FOMO (fear of missing out) attitude, the ensuing collapse in crude left investors woefully unprepared for the troubles of the next year and a half." What will be the catalyst that unleashes the next move lower? Here the answer according to BofA is simple: Trump. "If the Trump administration and the GOP are ineffectual in their agenda, would the US be looking at a replay of 2014 and 2015? From a macro perspective, could small business optimism return to pre-election levels or could consumption and capex finally take hold, and drive productivity and growth higher regardless of policy?" And this is where the negative bid comes into play: because, while not there entirely, BofA says it is "beginning to become concerned that bigger forces are at work in the US economy and that, without the implementation of tax reform and infrastructure spending, these issues will be exposed as potential problems." In short, when it comes to the economy, this is what is keeping BofA up at night: 1. Zombie Companies And Massive, Rising Debt Loads For one, there is evidence that inefficient companies have been incentivized to not invest over the last 7 years as cheap credit has allowed them to survive without the need to improve operations and invest. On the macro front, student loan debt has weighed on millennial consumption... ... retirees are less likely to spend in an environment of meager fixed income returns and prime age workers' real wages are increasing at sub 1% (Chart 6). Additionally, as Ally Financial, Synchrony and Capital One have all noted, net credit-card charge-offs and write-downs of auto debt are accelerating at a surprisingly fast clip. * * * 2. Sliding Used Car Prices, Rising Delinquencies And Subprime Defaults Falling used car prices have begun to impact suppliers and manufacturers, while banks have reportedly started pulling back on subprime auto debt as delinquencies creep higher. What's more, commercial real estate is arguably at peaks while the Fed hammers on lending standards and the retail sector is in disarray; affecting brick and mortar establishments, mall REITs and CMBS. * * * 3. Declining Loan Growth, Lack of commodity rebound and tighter balance sheet Loan growth is now negative and has only been at these levels around a recession (Chart 8), while tighter financial policy and a reduction of the balance sheet continues to be the rhetoric at the Fed. Corporate leverage remains high and commodity prices have not really recovered. For example, the average price of WTI for the last year has been $48.6/bbl while in 2015 it was $48.76/bbl; yet in 2015 high yield had a negative return and in 2017 the market is up 4.2% as of May 17th. To be fair, coming down from a high level is much worse than leveling off, and 20% of the market did default; having said that, we once again have first time issuers coming to market in Energy. * * * 4. Lack of Investment, No Small Business Creation And No EPS Confirmation Finally, small business formation continues to be weak while capex has remained anemic (Chart 10). Yet the S&P 500 is at near record levels despite the fact that EPS hasn't really changed in 3 years (Chart 9). * * * Of course, with the vix in the single digits, with stocks at all time highs, and central banks injecting record liquidity even now, BofA had to add some caveats: One could argue that the size of the auto loan market is not enough to impact growth in a meaningful way, that student debt could get better as the labor market continues to improve and that weak consumer spending was more a function of autos, spending on utilities and the effect of delayed tax returns: not necessarily an indicator of economic weakness. And although total consumer debt is now at record levels, the savings rate has increased so much that balance sheets have still improved. Additionally, non-commodity capex increased relative to trend in Q1, the Fed is unlikely to make a hawkish mistake given how careful they have been throughout the recovery - especially given the political uncertainty - and the global backdrop has arguably improved. Although China remains a concern, and oil has recently shown signs of weakness, neither seems to be as dire a situation as in 2015, in our view. Still, one can feel the urge in Contopoulos' writing to go back to the dark side. Here is his conclusion: So which economy is going to show up later this year and in 2018? We think the jury is still out. Much will depend, in our view, on whether or not the administration can pull together with the GOP to produce tax reform and restore what we think will be eroded confidence. If they're unable to do this, however, we think a 2014/2015 macro environment is the most likely scenario. Regardless, without a large sector rolling over, like Energy, and absent a recession, high yield likely muddles along, where longer duration and higher quality paper outperforms. And with that, it's now up to Trump to make or break this market. * * * Post-script: we are well on our way. Moments after this report was released, bank of America slashed both its Q1 and Q2 GDP forecasts, from 0.7% to 0.5% and 3.1% to 2.6%, respectively, after today's poor inventory and advance goods trade deficit data.

Выбор редакции
25 мая, 17:45

Форекс: мнение BofAML - 4 причины для покупки пары NZD/JPY

Bank of America Merrill Lynch FX Strategy Research отдает предпочтение длинным позициям по паре NZD/JPY на основании следующих 4 причин: 1. Короткое позиционирование по новозеландскому доллару наиболее "растянуто" среди валют G10. 2. Наш анализ данных свидетельствует о том, что риски для пары NZD/JPY являются восходящими 3. Динамика внутренних потоков становится все более благоприятной для пары USD/JPY и кросс-пар с участием иены. 4. Мы считаем, что "голубиная" позиция РБНЗ не является устойчивой. Риски: "глобальный шок или новые опасения в отношении Китая", добавляет BofML. В соответствии с этой точкой зрения BofAML рекомендует покупать NZD/JPY с помощью опционов. Информационно-аналитический отдел TeleTradeИсточник: FxTeam

25 мая, 16:23

FDIC-Insured Banks' Q1 Earnings Impressive, Costs Flare Up

Federal Deposit Insurance Corporation (FDIC)-insured commercial banks and savings institutions reported first-quarter 2017 earnings of $44 billion, up 12.7% year over year.

18 октября 2016, 23:42

Экономика. Курс дня. Эфир от 18 октября 2016 года

Ставка на технологии и на покупку технологий. Об этом говорил Владимир Путин на съезде "Деловой России". Обсудим тему и с генеральным директором Агентства по технологическому развитию Максимом Шерейкиным. Нефть по 50-60: именно такой диапазон Саудовская Аравия назвала достаточным и для бюджета и для развития мировой экономики. Джанет Йеллен дала пищу для ума. Послушав главу ФРС, Bank of America советует перекладывать деньги из облигаций – в реальные активы.

09 сентября 2016, 07:07

Вероятность того, что мы в "Матрице" будет только возрастать...

В опубликованной записке для клиентов Bank of America Merrill Lynch заявил о том, что человечество «с вероятностью от 20 до 50%» живет в смоделированной компьютером реальности, «матрице».В документе говорится, что к этой теории склоняются многие ученые -- и аргументом в поддержку этой версии является то, что человечество уже «приближается к технологии фотореалистичного 3D-моделирования, в котором могут одновременно участвовать миллионы людей».Можно предположить, что «с развитием искусственного интеллекта и компьютеров представители цивилизаций будущего могли решить создать симуляцию своих предков», говорится в письме банка клиентам.В документе приводятся мнения бизнесмена Илона Маска, шведского философа Ника Бострома и ученого Деграсса Тайсона. Маск ранее заявлял, что люди — это компьютерная игра другой цивилизации, Бостром выпустил книгу «А не живем ли мы в „Матрице“?», а Тайсон утверждал, что Вселенная — это всего лишь компьютерная модель.Банк приводит три возможных сценария для человечества. Первый — это вымирание до достижения «постчеловеческой» стадии. Второй — достижение «постчеловеческого» этапа, но без компьютерного моделирования истории. Третий вариант подразумевает, что люди уже находятся в «матрице»....Инвестиционные последствия остаются неясными...==========Я старшему сыну, который обожает виртуальный мир и мечтает более глубже в него вписаться, всё время объясняю, что это и есть (иногда иррациональная) мечта тех, кто конструирует наш новый удивительный мир -- с вполне ожидаемыми неплохими инвестиционными последствиями для держателей ванночек, в которых будут помещены будущие Нео.тыц

03 ноября 2015, 23:05

Регуляторы обновили список системно значимых банков

Совет по финансовой стабильности и Базельский комитет по финансовому надзору обновили список из 30 наиболее значимых банков в финансовой системе мировой экономики.

14 августа 2015, 11:02

Технологии глобального социального мошенничества (В. Павленко)

Считаю статьи этого товарища весьма урановешенными. Конспироложество - ярлыком. Букаф многа, но оно того, ИМХО, стоит.Соглашение TISA как манифест и дорожная карта установления частной олигархической власти.«…Бенефициар известен – глобальная олигархия, и поскольку это понятие мы пока ограничили суммой влиятельнейших мировых кланов Ротшильдов, Рокфеллеров и Ватикана, то настала пора перейти к конкретным, скрытым за всеми этими эвфемизмами, получателям прибыли. И, по “скромному” совместительству, соискателям мирового господства», - этим завершилась вторая часть статьи (http://www.iarex.ru/articles/51846.html).Вот и переходим к третьей, завершающей.Итак, появление проекта TISA автором было связано с провальными для олигархии итогами мирового финансового кризиса 2008-2009 годов. Почему, и что тогда случилось?В марте 2005 года в Техасе произошло событие, которое широкой огласке не предавалось. И потому не было по достоинству оценено экспертным сообществом. Тогда президенты США и Мексики Джордж Буш-младший и Висенте Фокс вместе с премьер-министром Канады Стивеном Мартином подписали соглашение «Партнерство ради безопасности и благосостояния в Северной Америке». Им предусматривалось создание нового межгосударственного объединения с единой валютной системой – Северо-Американского союза («The Union of North America» или «The North-American Union» – NAU).Спустя два месяца, в мае, аналитический центр американского Совета по международным отношениям (СМО) – влиятельнейшего концептуального объединения верхушки американских элит, - распространил доклад «Построение североамериканского общества». Предлагалось ограничить суверенитет США в вопросах торговой и иммиграционной политики, подчинив его интересам полного и окончательного надгосударственного объединения зоны NAFTA. Еще через месяц, в июне 2005 года, вице-президент СМО Роберт Пастор, выступая в комитете Сената США по внешней политике, предложил структуру североамериканского надгосударственного органа, аналогичного Европейской экономической комиссии (ЕЭК): 15 членов – по пять «заслуженных участников» от каждой из сторон – США, Канады и Мексики.Именно СМО, таким образом, и принадлежит идея введения в NAU единой валюты, аналогичной евро, - «амеро» или «североамериканского доллара». И эта валюта должна была заменить собой американский и канадский доллары и мексиканский песо.Закрытость «техасского процесса» объяснялась включением в него положения о последующем объединении NAU с ЕС в некий «Трансатлантический союз» (также с собственной валютой – уже не «амеро» и не евро). На эту сверхзасекреченную часть проекта тогда указал профессор Пьер Илляр из французской Высшей школы внешней торговли в книге «Разрушение европейских наций. Евро-Атлантический союз и мировое государство» (http://www.apn.ru/publications/article21896.htm). Иначе говоря, готовилось полное переформатирование мира. Начальной фазой его рассматривался долларовый дефолт.Однако заявленные сроки того проекта - NAU предполагалось запустить к 2010 году, а «Транс-Атлантику» – к 2015 году - уже минули, а ничего подобного так и не случилось.Что же представлял собой проект «Трансатлантического союза», и почему он провалился?На скромный взгляд автора этих строк, очень велика вероятность того, что соединиться два берега Атлантики могли только в Великобритании. И если это так, то валютой «Транс-Атлантики» становился бы фунт стерлингов, весьма предусмотрительно сохраненный отказом Туманного Альбиона от участия в валютном союзе в рамках еврозоны при вхождении этой страны в ЕС. Иначе говоря, в образе «Техасских соглашений» 2005 года миру была явлена важная, но отнюдь не решающая часть некоего закрытого проекта по объединению Запада путем фактического воссоздания Британской империи, причем, в глобальном масштабе. Как это и предсказывалось более чем за столетие до этого крупным идеологом глобализма Сесилом Родсом, основателем южно-африканских колоний, а также алмазной империи «De Beers» (1888 г.) и закрытого концептуального центра британской элиты – «Общества Круглого стола» (1891 г.). Именно вокруг него сложилась затем международная система подобных институтов, включая СМО (http://www.lt90.org/reviews/783-britanskaya_imperiya_ideologiya_globalnogo_dominirovaniya_ot_dzhona_di_do_sesila_rodsa.htm).В плане, раскрытом «Техасскими соглашениями», имелось только одно «узкое место» - весьма рискованный переход от «амеро» и евро к фунту стерлингов. Подобная «переправа» всегда представляет собой пресловутую «точку бифуркации». Процесс в ней на короткое время, которое в исчислении «техасского проекта» было ограничено максимум пятью годами – между созданием NAU и «Транс-Атлантики», - становится неуправляемым и чувствительным к любым внешним воздействиям. А они, эти воздействия, способны были направить его совсем не в ту сторону, куда планировалось авторами проекта. И потому англосаксы решили «подстраховаться», обеспечив переход от связки доллара или сменившего его «амеро» с евро к фунту стерлингов через китайский юань, который потребовался им как раз на эту «пересменку». Именно под это, в соответствии с договоренностями, достигнутыми с Китаем времен «четырех модернизаций» Дэн Сяопина, под китайский суверенитет в 1997 году вернули Гонконг, оговорив его экстерриториальность внутри КНР известной формулой «одна страна – две системы».Маленький нюанс: чтобы заменить доллар, обеспечив «транзит» от него к фунту стерлингов, юань должен был стать золотым, а золото в условиях отсутствия доллара – превратиться в новую единую меру стоимости (ЕМС). То есть в мерило всех материальных ценностей и эквивалент, по которому пересчитывались кросс-курсы всех валют. Иначе говоря, планировалось возвращение к золото-валютному стандарту, служившему стержнем глобальной финансовой системы до разрушения в 1971 году Бреттон-Вудской системы, когда при президенте Ричарде Никсоне доллар «отвязали» от золота и отпустили в «свободное плавание». Именно с тех пор и началось бурное развитие так называемого «финансового капитализма», породившего «мыльные пузыри» пустых финансовых обязательств – деривативов.Только стандарт предполагался не «золото-долларовый», а «золото-юаневый».Для контроля над всеми этими манипуляциями, получившими название «золотого проекта» Ротшильдов, решили задействовать механизм упоминавшейся в первой части статьи. А именно: «золотую пятерку» привилегированных банков, управляющих ценой золота, и замкнутые на нее, переплетенные между собой и с «пятеркой», частные (олигархические) и частно-государственные банковские сети в Европе и США (Inter-Alpha Group of Banks, European Financial Services Roundtable, Financial Services Forum). Напомним, что в эту «пятерку», включавшую два британских, канадский, французский и немецкий банки, контролировавшиеся Ротшильдами, входил банк HSBC (Hong Kong & Shanhai Banking Corporation), созданный во времена Опиумных войн при непосредственном участии ближайших партнеров этого клана из компании «Jardine Matheson Holdings». Сегодняшние преемники колониальных «банкстеров» XIX века Уильяма Джардина и Джеймса Матесона – Кезвики и Сазерленды – в интересах этого олигархического клана держат под фактическим контролем Банк Англии. Кроме того, они занимали ведущие позиции в ведущих финансовых компаниях, например, Goldman Sachs, и ключевых ТНК, скажем, в королевской British Petroleum. А еще возглавляли в свое время ВТО и закрытые глобалистские концептуальные структуры, например Трехстороннюю комиссию, где Питер Сазерленд директорствовал в европейской группе и т.д.Кроме HSBC, на место в «пятерке» вместо Deutsche Bank одно время претендовал другой британский колониальный банк, имеющий прочные позиции в Южной Африке и том же Гонконге, - Standard Chartered. Не сложилось, однако…Китаю под этот проект дали «зеленый свет» на быстрое расширение золотого запаса. В решающую фазу развитие событий вошло в 2008 году, с оглушительным обрушением банка Lehman Brothers, американские активы которого перешли к еще одному британскому члену «золотой пятерки» - банку Barclays, заменившему в ней в 2004 году ушедший «в тень» головной ротшильдовский банк N.M. Rothschild & Sons. Развязанный в управляемом режиме кризис по-видимому и должен был привести к глобальным изменениям в виде долларового дефолта, создания NAU и временного переноса «глобального финансового центра» в Юго-Восточную Азию – в Гонконг, Шанхай и Сингапур. Именно туда ближайшие соратники Ротшильдов - Джордж Сорос и его партнер Джим Роджерс - спешно вывели тогда из США активы своего спекулятивного фонда Quantum.После этого и планировалось, не торопясь, обстоятельно, обезопасив себя экономической, финансовой и военной мощью КНР, начать воссоздание глобальной Британской империи.Аналогичные «игры» велись и с Россией, правда, не так активно, как с Китаем. Доверия к Москве у Запада изначально было меньше, и взаимодействие планировали по «остаточному» принципу – «танцевали» от китайской «печки», исходя из того, что получится с Пекином. Если бы все «нормально» и «золотой проект», как говорится, «прокатывал», Россию собирались расчленить. И именно об этом от имени западных элит, уверенных в успехе на китайском направлении, в Москве в 2006 году поведал упоминавшийся в первой части статьи правящий князь Монако Альбер II.Если же с «золотым проектом» возникали проблемы, тогда на «пересменку» вместо Китая готовили Россию. И уже именно на это клюнули в 2012 году многочисленные внутренние апологеты слияния с Западом, с энтузиазмом воспринявшие авторский подвох про «стратегический альянс» с Рокфеллерами. Для справки: расчленение нашей страны на ЕТР и Сибирь с Дальним Востоком в глобалистских планах именовалось проектом «Сотовый мир III тысячелетия»; сохранение единства России с частичным воссоединением постсоветского пространства и переносом сюда олигархических интересов – проектом «Синдикат». Можно сколь угодно изощряться в юродстве относительно «склонности автора к конспирологии». Только нужно будет при этом объяснить хотя бы одно - существование в США характерного издания «Project Syndicate», в котором за прошедшие несколько лет были опубликованы очень многие интересные вещи. Например, статья североамериканского директора той же Трехсторонней комиссии Джозефа Ная-младшего «Проигрышная ставка Китая против Америки» (http://www.inosmi.ru/fareast/20100311/158553411.html). В ней матерый глобалист, с трудом сдерживая крайнее раздражение, балансируя на грани ненормативной по дипломатическим канонам лексики, пенял Пекину за отказ от предложенного ему двухпартийным американским консенсусом (Бжезинским и Киссинджером) проекта G2 – «большой двойки», смысл которой заключался в разделе советского наследства.Происходило это в марте 2010 года, как раз тогда, когда до концептуальных инстанций и кругов США и ЕС, наконец, в полной мере дошло, что «гладко было на бумаге, да забыли про овраги». И что одним махом «навернулись» обе «промежуточные» ставки – и китайская, и российская. Предложение Альбера II обернулось в феврале 2007 года памятной мюнхенской речью Владимира Путина. В Китае же вслед за ней очень скоро «завернули» американскую инициативу G2. Ибо не готовы были плясать под американскую «дудку». И, кроме того, прекрасно отдавали себе отчет в том, что возвысить Поднебесную США собирались отнюдь не бесплатно, а также:- во-первых, под жестким внешним контролем олигархии,- во-вторых, лишь на короткое время,- в-третьих, ликвидация Россия оставляла Китай один на один с Западом,- в-четвертых, пользуясь этим, олигархи, с последующим уходом на Британские острова, собирались разделить на части и саму КНР.На Интернет-портале Фонда братьев Рокфеллеров (Rockefeller Brothers Fund) об этом сказано по сути открытым текстом: в число «пилотных регионов» фонда включен «южный Китай» (http://www.rbf.org/program/pivotal-place-southern-china). Именно существование этого проекта и побудило нового Председателя КНР и Генерального секретаря ЦК КПК Си Цзиньпина сразу после прихода к власти жестко заявить, что он никогда «не станет китайским Горбачевым».На фоне этих знаковых тенденций и событий и началось сближение России и Китая, спасительное для наших двух стран и возможно фатальное для Запада. Когда в США и ЕС дали «отмашку» кризису, Москва и Пекин сделали мощный ответный ход, повергший в шок, отрезвивший и спутавший все планы их оппонентов. В середине марта 2009 года, за две недели до важнейшего саммита «Группы двадцати» в Лондоне, президенты России и Казахстана предложили ввести новую мировую резервную валюту. При этом Нурсултан Назарбаев обратил внимание на предложение главы Народного банка Китая Чжао Сяочуаня взять за основу такой валюты юань (http://www.garant.ru/products/ipo/prime/doc/94176/; http://baursak.info/?p=673).Если не углубляться в детали официального российского предложения саммиту «двадцатки», то инициатива сводилась к превращению в такую валюту электронной валюты МВФ – SDR (Special Draw Rights). Или, по-русски, «специальных прав заимствования». С дополнением образующей их «корзины валют» - доллара, евро, фунта стерлингов и иены еще и рублем, юанем и, главное, золотом (http://archive.kremlin.ru/text/docs/2009/03/213992.shtml). Иначе говоря, Россия и Китай сами предложили глобальным олигархам в лице США и ЕС запустить тот самый «золотой проект», ради которого те разжигали кризис. И олигархи сначала задумались, причем настолько крепко, что стали лихорадочно проводить незапланированные закрытые встречи и совещания, решая, что делать и как не угодить в ловушку. А затем, почуяв недоброе, так и не решились сделать шаг «навстречу своей мечте». Вместо этого струсили и отползли. 23 марта, через неделю после российско-китайской инициативы, все три основные американские властные инстанции – президент Обама, министр финансов Гайтнер и глава ФРС Бернанке – ответили на российское предложение решительным отказом, после чего оно, сыграв уже свою роль, было отозвано. А 1 апреля, на лондонском саммите «двадцатки», «полпреды» олигархов из числа западных лидеров решали уже не вопрос американского дефолта, а совсем другой: какие институты создать, чтобы заблокировать и спустить на тормозах ими самими же и раздутый кризис. Тогда в структуре G20 и появился Совет по финансовой стабильности (FSB – Financial Stability Board), в адрес которого Владимир Путин отпустил в те судьбоносные дни ехидную, но остроумную шутку, что «без ФСБ – никуда».Кризис олигархи в итоге залили деньгами – вместо официальных 700 млрд долларов «плана Полссона» и 4 трлн признанных, что они были выплачены на самом деле, банкам на льготных условиях ссудили, ни много ни мало, 16,1 (!) трлн долларов (http://www.inoforum.ru/inostrannaya_pressa/slyshali_li_vy_o_16-ti_trillionah_dollarov_vbroshennyh_federalnoj_rezervnoj_sistemoj_v_slishkom_bolshie_chtoby_razoritsya_banki/). Кроме того, под «заливание кризиса зеленой наличностью» также создали еще и пул «системно важных» («слишком больших, чтобы лопнуть») олигархических институтов и банков, оформив его в рамках FSB с помощью соответствующих, ежегодно обновляемых, списков претендентов на финансовую помощь (G-SIFIs и G-SIBs). По сути, еще двух глобальных банковских сетей, дополняющих упомянутые автором выше.ФРС, а затем и ЕЦБ в связи с этим поэтапно приступили к длительным «программам количественного смягчения», то есть попросту запустили на полную мощь свои «печатные станки», сначала США, затем Европа.Значительный рост цены на золото, которая контролировалась «золотой пятеркой», тем не менее продолжился: олигархи еще на что-то надеялись. На что именно? Под «это дело» они попытались нажать на Китай, используя внутренние расклады в партийно-государственном руководстве в преддверии состоявшегося в ноябре 2012 года XVIII съезда КПК. Но когда за три месяца до этого, в сентябре того же года, стало ясно, что и эти надежды не оправдались, цена золота просто-таки в одночасье обрушилась. И стабилизировалась на несравненно более низком, далеком от прежних пиков, уровне, долгое время затем пребывая в состоянии неустойчивого равновесия. Не желая более «накачивать» золото-валютные резервы КНР, олигархи явно «чесали репу», думая, что делать дальше в условиях, когда ни Китай, ни Россия с ними сотрудничать не стали, использовать себя не позволили и, кроме того, начали конструировать на основе объединения БРИКС реальную глобальную альтернативу олигархическому господству.Думали-думали – и придумали. Несостоявшийся «золотой проект» и заменило обсуждаемое нами соглашение TISA. Разрабатывать его стали в 2012-2013 годах, в привязке к упомянутым Транс-Тихоокеанскому (TPP) и Трансатлантическому (TTIP) партнерствам. С их помощью решили минимизировать последствия провала 2009 года, переформатировав мир несколько иначе, чем ранее предполагалось. В частности, сохранив, по крайней мере пока, центр в США и подтянув к нему и укрепив олигархическое влияние в странах Азиатско-Тихоокеанского региона (АТР) и ЕС. Жесточайший режим секретности в этих соглашениях, оформляющих вроде бы скромные зоны свободной торговли, и указывает на стратегический характер этого нового проекта. Именно под него в феврале 2015 года «приказала долго жить» превратившаяся в «четверку» с обрушением цен на золото «золотая пятерка». И именно поэтому к участию в переговорах по TISA, с одной стороны, не пригласили ни одну из стран БРИКС, а с другой, - пытаются «офлажковать» Китай включением в этот проект Гонконга и Тайваня.Не будет преувеличением назвать соглашение TISA «Техасом №2» или реинкарнацией «техасского проекта». Разница геополитическая: не берега Атлантики соединяются в Лондоне, а Атлантический и Тихий океаны – в Вашингтоне. Точнее, в Нью-Йорке – этом «городе желтого дьявола», где расположен центр настоящей, финансовой власти США, а не находящейся у нее на подхвате квазиполитической. И поскольку «техасский процесс» одним только Западом ограничиваться явно не собирался, есть подозрение, что олигархи просто пытаются перепрыгнуть этот этап строительства «глобальной империи», сразу предъявляя претензии на полноценное мировое господство.Является ли соглашение TISA самостоятельным проектом или перенос мирового центра в Лондон остается в повестке дня? Дать точный прогноз сейчас сложно. Можно лишь предположить, что это возможно, ибо все перечисленные маневры никак не сняли и не могут снять главную проблему, ради решения которой и затеяны. А именно: многотриллионный государственный долг США, который давно уже превратил эту вотчину глобальной олигархии в банкрота, избегающего дефолта только потому, что на территории этой квазистраны находится «печатный станок». И проблема эта олигархию обещает похоронить, поэтому попытку разрешить ее, и возможно еще не одну, она, олигархия, несомненно предпримет. Фокус, однако, в том, что сама Америка как государство «станок» не контролирует и своей национальной валюты не имеет: нет доллара США, есть доллар ФРС, то есть не американский, а глобально-олигархический. И США потому «плыли по ветру», плывут, и впредь будут плыть в ту сторону, куда олигархия дует.А куда она дует? Это стало по-настоящему заметно лишь на рубеже 2014-2015 годов и вряд ли случайно совпало с крахом «золотой пятерки». Именно в это время появилась, точнее, была вброшена в СМИ и начала интенсивно раскручиваться в информационном поле тема узкого круга управляющих компаний, контролирующих огромные активы. Началось все раньше, с исследования специалистов Швейцарского федерального технологического института (ШФТИ), которые в 2011 году выявили интересные детали управления мировой экономикой. Подвергнув анализу взаимные связи и зависимости 43-х тыс. ТНК, они выявили «ядро» в составе 1318 корпораций. Копнув еще глубже, нашли в этом «ядре» некое «суперядро» - 147 крупнейших компаний, тесно связанных и переплетенных между собой взаимным участием в акционерном капитале. Оказалось что участниками этого «субъекта-147» контролируются 40% мировой экономики, в том числе 90% (!) банковского сектора (http://www.fondsk.ru/news/2013/01/15/o-supersubekte-ili-komitet-147-18680.html). Занимавшийся, как видим, поиском и анализом швейцарских материалов известный экономист Валентин Катасонов (отдадим ему должное за высокое качество проделанной работы, давшей интереснейшие результаты) выяснил, что швейцарцы нашли еще много занимательного. В частности, расставили компании этого «списка 147-ми» по ранжиру. Вот первая десятка:1. Barclays plc;2. Capital Group Companies, Inc;3. FMR (Fidelity Management Research) Corporation;4. AXA;5. State Street Corporation;6. J.P. Morgan Chase & Co;7. Legal & General Group plc;8. Vanguard Group, Inc;9. UBS AG;10. Merrill Lynch & Co, Inc.«Важное обстоятельство: все 10 строчек швейцарского списка занимают организации финансового сектора, - подчеркивает Катасонов. - Из них четыре – банки, названия которых у всех на слуху, одного из них – Merrill Lynch – уже не существует (в ходе кризиса поглощен Bank of America, и этот конгломерат с тех пор носит название Bank of America Merill Lynch. – Авт.). Особо отметим американский банк J.P. Morgan Chase & Co. Это не просто банк, а банковский холдинг, участвующий в капиталах многих других американских банков. …J.P. Morgan Chase участвует в капитале всех других банков “большой шестерки” за исключением банка Goldman Sachs. В банковском мире США есть еще один примечательный банк, который формально не входит в “большую шестерку”, но который невидимо контролирует некоторые из банков “большой шестерки”. Речь идет о банке The Bank of New York Mellon Corporation. Указанный банк являлся держателем акций в Citigroup (доля 1,24%), J.P. Morgan Chase (1,48%), Bank of America (1,25%).А вот шесть строчек швейцарского списка, - продолжает В. Катасонов, - принадлежат финансовым компаниям, редко фигурирующим в открытой печати. Это финансовые холдинги, которые специализируются на приобретении по всему миру пакетов акций компаний разных отраслей экономики. Многие из них учреждают различные инвестиционные, в том числе взаимные, фонды, осуществляют управление активами клиентов на основе договоров траста и т.д. В этом списке мы видим три финансовые компании из “большой четверки”…: Vanguard Group, Inc, FMR Corporation (Fidelity) и State Street Corporation. (Добавим сюда еще одну – Capital Group Companies, Inc; и не только потому, что в швейцарском списке она занимает вторую позицию. – Авт.). Эти финансовые холдинги, а также компания BlackRock (сильно укрепившая свои позиции с 2007 года) и образуют ядро банковской системы США», - резюмирует В. Катасонов. Как осуществляется этот контроль?Вот так, например: http://finance.yahoo.com/q/mh?s=MSFTИли, скажем, так: http://finance.yahoo.com/q/mh?s=GD+Major+HoldersЗаметим, что в первой из приведенных ссылок показана структура акционерного капитала Microsoft Corporation – ведущей ТНК в сфере IT-технологий; во второй ссылке фигурирует такая же структура General Dynamics – ключевой ТНК военно-промышленного комплекса. И так все сектора и корпорации по порядку, без исключения.Окончание статьи здесь: http://aftershock.su/?q=node%2F322947

11 августа 2015, 20:32

ФБР арестовало группу хакеров из Украины и США

Правоохранительные органы США арестовали группу злоумышленников, которые подозреваются в незаконном получении конфиденциальной информации, которую впоследствии использовали для операций с ценными бумагами.

04 августа 2015, 19:21

Глобальная мировая бизнес-сеть

Хотя точнее её было бы назвать не мировой, а всё же американской. Потому что мировая она по охвату, но по центру владения собственностью и принятия решений она - американская. Эту инфографику опубликовали в июне этого года на сайте InfoWeTrust.com на основании статистики Bloombergresearch. Она отражает связи руководящего состава крупнейших международных компаний. Члены советов директоров одновременно занимают директорские должности в нескольких компаниях, что, как понимаете, конфликтует с заявляемой «свободой конкуренции»: если «рука рынка» в лице конкретного директора руководит конкурентами, то это какая-то странная конкуренция, как думаете? Впрочем, это не новость: в 2002 году газеты USA Today и The Financial Times проводили исследование связей между членами советов директоров крупнейших корпораций мира на основе аналитической базы The Corporate Library. Выяснилось, что в ведущих 500 компаниях мира каждый седьмой директор входит в совет директоров другой корпорации. В «личном первенстве» лидировал президент немецкой страховой компании «Allianz» Хеннинг Шульте-Нелле, который в 2002 году заседал в советах директоров разных компаний со 184 руководителями крупнейших компаний мира. USA Today выяснили, что в 11 из 15 крупнейших компаний США двое и более директоров входят в совет директоров другой компании. Ситуацию образно описал профессор Мичиганского университета Джеральд Дэвис: «Если бы член совета директоров JP Morgan Chase подхватил вдруг заразную болезнь, в течение шести месяцев заразились бы 97% директоров крупных компаний». Этот феномен даже имеет свое название — «interlocking directorate» (совмещенный директорат), что указывает на устойчивость явления. Формально, по законам США, такое запрещено для конкурирующих компаний, но конкуренция-то не всегда прямая, да и важна сама возможность общения. Например, компании «PepsiCo» и «Coca-Cola» – традиционные конкуренты и не участвуют в управлении друг другом, однако члены совета директоров «PepsiCo» Роберт Аллен и Джеймс Робинсон («Coca-Cola») вместе заседают в совете директоров фармацевтической компании «Bristol-Myers Squibb». Нетрудно догадаться, что ведущую роль в такой «кооперации» играют крупные финансовые фонды и банки. Либеральные мантры о «свободе конкуренции» лишь служат идеологическим прикрытием централизации капитала. Так, крупных брендов в мире значительно больше, чем их владельцев — компании стремятся перекрыть рынок разными марками товаров от одного владельца, а не допускать каких-то там конкурентов к дележу «пирога».

15 июня 2015, 11:57

Scofield: Бильдербергский клуб определил зоны интересов ВПК

В четверг открылась очередная ежегодная встреча членов Бильдербергского клуба. Среди 133 гостей, собравшихся на этой неделе в австрийском городке Тельфс-Бюхен, 21 политик. В их числе – министр финансов Великобритании Джордж Осборн...

13 мая 2015, 04:23

По конспироложествуем об очередных кандидатах в члены мирового правительства?

Банки правят миром. А кто правит банками? Сегодня уже не надо доказывать, что пресловутая гегемония США зиждется на монополии печатного станка Федеральной резервной системы (ФРС). Более или менее понятно также, что акционерами ФРС выступают банки мирового калибра. В их число входят не только банки США (банки Уолл-стрит), но и европейские банки Европы (банки Лондонского Сити и некоторых стран континентальной Европы). В период мирового финансового кризиса 2007-2009 гг. ФРС, действуя без огласки, раздала разным банкам кредитов (почти беспроцентных) на сумму свыше 16 трлн. долл. Хозяева денег раздавали кредиты самим себе, то есть тем банкам, которые и являются главными акционерами Федерального резерва. В начале текущего десятилетия под сильным нажимом Конгресса США был проведен частичный аудит ФРС, и летом 2011 года его результаты были обнародованы. Список получателей кредитов и есть список главных акционеров ФРС. Вот они (в скобках указаны суммы полученных кредитов ФРС в миллиардах долларов): Citigroup (2500); Morgan Staley (2004); Merril Lynch (1949); Bank of America (1344); Barclays PLC (868); Bear Sterns (853); Goldman Sachs (814); Royal Bank of Scotland (541); JP Morgan (391); Deutsche Bank (354); Credit Swiss (262); UBS (287); Leman Brothers (183); Bank of Scotland (181); BNP Paribas (175). Примечательно, что целый ряд получателей кредитов ФРС - не американские, а иностранные банки: английские (Barclays PLC, Royal Bank of Scotland, Bank of Scotland); швейцарские (Credit Swiss, UBS); немецкий Deutsche Bank; французский BNP Paribas. Указанные банки получили от Федерального резерва около 2,5 триллиона долларов. Не ошибёмся, если предположим, что это – иностранные акционеры ФРС. Однако если состав главных акционеров Федрезерва более или менее понятен, то этого не скажешь в отношении акционеров тех банков, которые, собственно, и владеют печатным станком ФРС. Кто же является акционерами акционеров Федерального резерва? Прежде всего, рассмотрим ведущие банки США. На сегодняшний день ядро банковской системы США представлено шестью банками. «Большая шестерка» включает Bank of America, JP Morgan Chase, Morgan Stanley, Goldman Sachs, Wells Fargo, Citigroup. Они занимают первые строчки американских банковских рейтингов по таким показателям, как величина капитала, контролируемых активов, привлеченных депозитов, капитализация, прибыль. Если ранжировать банки по показателю активов, то на первом месте оказывается JP Morgan Chase (2.075 млрд. долл. в конце 2014 г.). По показателю капитализации первое место занимает Wells Fargo (261,7 млрд. долл. осенью 2014 года). Кстати, по этому показателю Wells Fargo вышел на первое место не только в Америке, но и в мире (хотя по активам в США он занимает лишь четвертое место, а в мире даже не входит в первую двадцатку). На официальных сайтах этих банков имеется кое-какая информация об акционерах. Основная часть капитала «большой шёстерки» американских банков находится в руках так называемых институциональных акционеров – разного рода финансовых компаний. Среди них есть и банки, то есть имеет место перекрестное участие в капитале. Количество институциональных инвесторов на начало 2015 года в отдельных банках было следующим: Bank of America – 1410; JP Morgan Chase – 1795; Morgan Stanley – 826; Goldman Sachs – 1018; Wells Fargo – 1729; Citigroup – 1247. В каждом из названных банков достаточно четко выделяется группа крупных инвесторов (акционеров). Это те инвесторы (акционеры), которые имеют более 1 процента капитала каждый. Таких акционеров насчитывается, как правило, от 10 до 20. Бросается в глаза, что во всех банках в группе крупных инвесторов фигурируют одни и те же компании и организации. В табл. 1 приведем список таких крупнейших институциональных инвесторов (акционеров). Табл. 1. Источник: http://finance.yahoo.com/q/mh?s=GS+Major+Holders   Кроме обозначенных в таблице институциональных инвесторов в списках акционеров ведущих американских банков присутствуют следующие организации: Capital World Investors, Massachusetts Financial Services, Price (T. Rowe) Associates Inc., Mitsubishi UFJ Financial Group, Inc., Berkshire Hathaway Inc., Dodge & Cox Inc., Invesco Ltd., Franklin Resources, Inc., Bank of New York Mellon Corporation и некоторые другие. Я называю лишь те, которые фигурируют в качестве акционеров хотя бы в двух из шести ведущих банков США. Фигурирующие в финансовой отчетности ведущих американских банков институциональные акционеры – это различные финансовые компании и банки. Отдельный учет ведется в отношении таких акционеров, как физические лица и взаимные фонды. В целом ряде банков Уолл-стрит заметная доля акций принадлежит работникам этих банков. Разумеется, это не рядовые сотрудники, а ведущие менеджеры (впрочем, некоторое символическое количество акций могут иметь и рядовые банковские служащие). Что касается взаимных фондов (mutual funds) (1), то многие из них находятся в сфере влияния все тех же институциональных акционеров, которые названы выше. В качестве примера можно привести список наиболее крупных акционеров американского банка Goldman Sachs, относящихся к категории взаимных фондов (табл. 2). Табл. 2. Источник: finance.yahoo.com По крайней мере три фонда из приведенных в таблице 2 находятся в сфере влияния финансовой корпорации Vanguard Group. Это Vanguard Total Stock Market Index Fund, Vanguard 500 Index Fund, Vanguard Institutional Index Fund-Institutional Index Fund. Доля Vanguard Group в акционерном капитале Goldman Sachs – 4,90%. А три взаимных фонда, находящихся в системе этого финансового холдинга, дают дополнительно еще 3,59%. Таким образом, фактически позиции Vanguard Group в банке Goldman Sachs определяются долей не 4,90%, а 8,49%. В ряде банков Уолл-стрит имеется категория индивидуальных акционеров – физических лиц. Как правило, это высшие руководители данного банка, как действующие, так и ушедшие на пенсию. Приведем справку об индивидуальных акционерах банка Goldman Sachs (табл. 3). Табл. 3. Источник: finance.yahoo.com В совокупности указанные в табл. 3 пять физических лиц имеют на руках более 5,5 млн. акций банка Goldman Sachs, что составляет примерно 1,3% всего акционерного капитала банка. Это столько же, сколько акций у такого институционального акционера, как Northern Trust. Кто эти люди? Высшие менеджеры Goldman Sachs. Ллойд Бланкфейн, например, - председатель совета директоров и главный исполнительный директор Goldman Sachs с 31 мая 2006 года. Джон Вайнберг – вице-президент Goldman Sachs с того же времени, одновременно член управляющего комитета и сопредседатель подразделения инвестиционного банкинга (последний пост он оставил в декабре 2014 года). Три других индивидуальных акционера также относятся к категории высшего менеджмента банка Goldman Sachs, причем все являются действующими сотрудниками данного банка. Достаточно ли нескольких процентов участия в акционерном капитале для того, чтобы эффективно управлять банком? Тут следует учесть, по крайней мере, три момента. Во-первых, в ведущих банках США давно уже нет очень крупных акционеров. Формально в этих банках нет ни одного акционера, доля которого была бы выше 10%. Общее число институциональных акционеров (инвесторов) в американских банках колеблется в пределах одной тысячи. Получается, что в среднем на одного институционального акционера приходится примерно 0,1 процента капитала. На самом деле - меньше, поскольку кроме них есть еще взаимные фонды (учитываемые отдельно), а также многие тысячи физических лиц. В ряде банков акциями владеют служащие. В случае банка Goldman Sachs в руках физических лиц находится около 7% акционерного капитала. Наконец, часть акций находятся в свободном обращении на фондовом рынке. С учетом распыления акционерного капитала среди десятков тысяч держателей бумаг владение даже 1 процентом акций банка Уолл-стрит – это очень мощная позиция. Во-вторых, за несколькими (или многими) формально самостоятельными акционерами может стоять один и тот же хозяин - конечный бенефициар. Скажем, хозяева финансового холдинга Vanguard Group участвуют в капитале банка Goldman Sachs и напрямую, и через взаимные фонды, находящиеся в сфере влияния указанного холдинга. Скорее всего, доля Vanguard Group в капитале Goldman Sachs не 4,90% (доля материнской компании) и не 8,49% (доля с учетом трех подконтрольных взаимных фондов), а больше. Нельзя сбрасывать со счетов и акционеров – физических лиц, чей удельный вес намного выше, чем их доля в акционерном капитале, поскольку это высшие менеджеры, поставленные на руководящие должности теми, кого называют «конечными бенефициарами». В-третьих, есть такие акционеры, влияние которых на политику банка превышает их долю в акционерном капитале по той причине, что они владеют так называемыми голосующими акциями. В то же время другие акционеры владеют так называемыми привилегированными акциями. Последние дают их владельцам такую привилегию, как получение фиксированного дивиденда, но при этом лишают их владельца права голосования на собраниях акционеров. Скажем, акционер может иметь долю в капитале банка, равную 5%, но при этом его доля в общем количестве голосов может быть 10, 20 или даже 50%. А привилегия решающего голоса для банков Уолл-стрит может иметь гораздо большее значение, чем привилегия получения гарантированного дохода. Вернемся к табл. 1 в первой части статьи. Она показывает, что почти во всех американских банках главными акционерами являются финансовые холдинги. При этом если названия ведущих банков Уолл-стрит сегодня известны всем, то названия финансовых холдингов, владеющих большими пакетами акций этих банков, говорят о чем-то лишь очень узкому кругу финансистов. А ведь речь идет о тех, кто в конечном счете контролирует банковскую систему США и Федеральную резервную систему. Например, в последнее время довольно часто упоминался инвестиционный фонд Franklin Templeton Investments, который скупил долговые бумаги Украины на 7-8 млрд. долл. и активно участвует в экономическом удушении этой стран. Между тем указанный фонд – дочерняя структура финансового холдинга Franklin Resources Inc., который является акционером банка Citigroup (доля 1,24%) и банка Morgan Stanley (1,40%). Такие финансовые холдинги, как Vanguard Group, State Street Corporation, FMR (Fidelity), Black Rock, Northern Trust, Capital World Investors, Massachusetts Financial Services, Price (T. Rowe) Associates Inc., Dodge & Cox Inc.; Invesco Ltd., Franklin Resources, Inc., АХА, Capital Group Companies, Pacific Investment Management Co. (PIMCO) и еще несколько других не просто участвуют в капитале американских банков, а владеют преимущественно голосующими акциями. Именно эти финансовые компании и осуществляют реальный контроль над банковской системой США. Некоторые аналитики полагают, что акционерное ядро банков Уолл-стрит составляют всего четыре финансовые компании. Другие компании-акционеры либо не относятся к категории ключевых акционеров, либо прямо или через цепочку посредников контролируются все той же «большой четвёркой». В табл. 4 представлена сводная информация о главных акционерах ведущих банков США. Табл. 4. Оценки величины активов, находящихся в управлении финансовых компаний, являющихся акционерами главных банков США, достаточно условны и периодически пересматриваются. В некоторых случаях оценки включают лишь собственные активы компаний, в других случаях – ещё и активы, передаваемые компаниям в трастовое управление. В любом случае величина контролируемых ими активов впечатляет. Осенью 2013 года в списке мировых банков, ранжированных по величине активов, на первом месте находился китайский банк Industrial and Commercial Bank of China (ICBC) с активами 3,1 трлн. долл. Максимальные активы в банковской системе США на тот момент имел банк Bank of America (2,1 трлн. долл.). За ним следовали такие американские банки, как Citigroup (1,9 трлн. долл.) и Wells Fargo (1,5 трлн. долл.). Примечательно, что триллионными активами финансовые холдинги «большой четвёрки» ворочают при использовании достаточно скромного числа сотрудников. При совокупных активах, равных примерно 15 трлн. долл., персонал «большой четвёрки» не дотягивает до 100 тыс. человек. Для сравнения: численность сотрудников лишь в банке Citigroup составляет около 250 тыс. человек, в Wells Fargo – 280 тыс. человек. В сравнении с финансовыми холдингами «большой четвёрки» банки Уолл-стрит выглядят рабочими лошадками. По показателю контролируемых активов финансовые компании «большой четвёрки» находятся в более тяжелой весовой категории, чем американские банки «большой шестёрки». «Большая четвёрка» финансовых холдингов простирает свои щупальца не только на банковскую систему США, но и на компании других секторов американской и зарубежной экономики. Тут можно вспомнить исследование специалистов Швейцарского технологического института (Цюрих), целью которого было выявить управляющее ядро мировой экономической и финансовой системы. В 2011 году швейцарцы причислили к ядру мировых финансов 1218 компаний и банков по состоянию на начало финансового кризиса (2007 год). Внутри этого конгломерата было выявлено еще более плотное ядро из 147 компаний. По оценкам авторов исследования, это малое ядро контролировало 40% всех корпоративных активов в мире. Компании ядра были швейцарскими исследователями ранжированы. Воспроизведем первую десятку этого рейтинга: 1. Barclays plc 2. Capital Group Companies Inc 3. FMR Corporation 4. AXA 5. State Street Corporation 6. JP Morgan Chase & Co 7. Legal & General Group plc 8. Vanguard Group Inc 9. UBS AG 10. Merrill Lynch & Co Inc. Важное обстоятельство: все 10 строчек швейцарского списка занимают организации финансового сектора. Из них четыре – банки, названия которых у всех на слуху (одного из них – Merrill Lynch – уже не существует). Особо отметим американский банк JP Morgan Chase & Co. Это не просто банк, а банковский холдинг, участвующий в капиталах многих других американских банков. Как видно из табл. 1, JP Morgan Chase участвует в капитале всех других банков «большой шестёрки» за исключением банка Goldman Sachs. В банковском мире США есть еще один примечательный банк, который формально не входит в «большую шестёрку», но который невидимо контролирует некоторые из банков «большой шестёрки». Речь идет о банке The Bank of New York Mellon Corporation. Указанный банк являлся держателем акций в Citigroup (доля 1,24%), JP Morgan Chase (1,48%), Bank of America (1,25%). А вот шесть строчек швейцарского списка принадлежат финансовых компаниям, редко фигурирующим в открытой печати. Это финансовые холдинги, которые специализируются на приобретении по всему миру пакетов акций компаний разных отраслей экономики. Многие из них учреждают различные инвестиционные, в том числе взаимные, фонды, осуществляют управление активами клиентов на основе договоров траста и т.д. В этом списке мы видим три финансовые компании из «большой четвёрки», отображенной в табл. 4: Vanguard Group Inc, FMR Corporation (Fidelity) и State Street Corporation. Эти финансовые холдинги, а также компания Black Rock (сильно укрепившая свои позиции с 2007 года) и образуют ядро банковской системы США. Примечательно, что «большая четвёрка» очень хорошо представлена и в банковском холдинге JP Morgan Chase: Vanguard Group – 5,46%; State Street Corporation – 4,71%; FMR Corporation (Fidelity) – 3,48%; Black Rock – 2,75%. Другой из названных выше банковских холдингов – The Bank of New York Mellon Corporation – контролируется тремя финансовыми компаниями «большой четвёрки»: Vanguard Group – 5,15%; State Street Corporation – 4,72%; FMR Corporation (Fidelity) Black Rock – 2,62%. После того как мы выявили управляющее ядро банковской системы США, состоящее из небольшого количества финансовых холдингов, возникает ряд новых вопросов. Кто является владельцами и конечными бенефициарами этих финансовых холдингов? Как далеко распространяется влияние этих финансовых холдингов в отраслевом и географическом отношениях? Можно ли утверждать, что подход к объяснению происходящего в сфере мировых финансов на основе концепции «борьбы кланов Ротшильдов и Рокфеллеров» устарел? Однако это уже тема другого разговора. (1) Взаимный фонд (ВФ), или фонд взаимных инвестиций  - это портфель акций, приобретённых профессиональными финансистами на вложения многих тысяч мелких вкладчиков. К началу XXI века в США действовало несколько тысяч взаимных фонов. К 2000 году в рамках взаимных фондов было открыто 164, 1 млн. счетов, то есть около двух на семью.

20 октября 2014, 10:09

Цены на нефть: катастрофа для СПГ-проектов Австралии

 Длительное снижение цен на нефть угрожает расширению промышленности сжиженного природного газа (СПГ), а также повышает риск снижения доходов для разработчиков СПГ-проектов в Австралии, которая стремится к тому, чтобы стать крупнейшим поставщиком СПГ в мире. На сырьевом рынке продолжается обвал. Нефть дешевеет практически без остановки, цена за бочку смеси Brent опустилась уже ниже $83.Экспорт СПГ Австралии привязан к цене на нефть, которая снижалась с июня этого года. Цена на нефть марки Brent достигла четырехлетнего минимума в $82,60 за баррель на прошлой неделе. Газовая промышленность Австралии уже столкнулась со значительными расходами, так как компании от BG Group до Chevron строят семь предприятий, ориентированных на экспорт для удовлетворения спроса в Азии. Организаторы проектов в стране изучают новые возможности для инвестирования на сумму около 180 млрд австралийских долларов. Катастрофа Динамика нефти BrentСнижение цен на нефть может привести к тому, что СПГ-проекты могут "простаивать в течение нескольких лет", заявил в интервью Фереидун Фешараки, глава промышленного консалтингового агентства Facts Global Energy: "Что касается проектов, которые уже в процессе строительства, то это сильно ударит по карману разработчиков". Если цены на нефть опустятся ниже $80 за баррель, то это может стать “катастрофой” для некоторых проектов, говорит Фешараки, согласно прогнозам которого цена на нефть Brent может опуститься до $60 за баррель до конца года, а затем подняться до $80 к концу 2015 г. Говоря о ситуации в 2012 г., он назвал снижение цен на нефть более важной проблемой для СПГ-промышленности Австралии, чем конкуренция со стороны США. Долгосрочный прогноз компании Origin Energy на экономику ее проекта с ConocoPhillips остается без изменений, заявили на прошлой недели представители компании. Представители Origin также заявили, что компании необходима цена как минимум в $55 за баррель на протяжении срока реализации проекта, чтобы покрыть затраты. Защита поставщиков Динамика нефти Brent с 2004 г.Как заявили сегодня представители компании BG, австралийский проект, осуществление которого намечено на конец года, является прибыльным "при широком спектре цен на нефть". Экспорт Австралии основан на 20-летних контрактах. В некоторых прописана минимальная цена в районе $40-60 за баррель и максимальная - в районе $80-110 за баррель согласно исследованию Оксфордского института энергетических исследований. Это сделано для того, чтобы защитить поставщиков и покупателей от серьезных изменений цены на нефть, говорит Джеффри Канн, глава нефтегазового подразделения Deloitte в Австралии. Если будут снижены прогнозы цен на нефть, то "развитие газовой промышленности в Австралии станет очень затруднительным, так как добыча в Австралии очень высокозатратна", говорит он. В Австралии сейчас строятся СПГ-проекты на общую сумму около $190 млрд. Под вопросом также оказались такие проекты, как заводы СПГ компании Woodside Petroleum - Browse и Sunrise, а также добыча Exxon Mobil на месторождении Scarborough. Total, InterOil Российский рынок акций в четверг отыгрывает большую часть потерь. В Америке накануне площадки закрылись в минусе. Артем Аргеткин, эксперт компании БКС, рассказывает об основных событиях этого дня.В соседней Папуа - Новой Гвинее компания Exxon ищет возможности расширения своего бизнеса, а компании Total и InterOil планируют расширение экспорта газа. Нефть марки Brent может упасть до $78 за баррель в течение следующих трех месяцев согласно отчету UBS AG, опубликованному на прошлой неделе, в то время как Bank of America и BNP Paribas прогнозируют, что цены на нефть останутся выше $80 за баррель. Societe Generale снизил прогноз на 2015 г. на $12 за баррель до $91 за баррель. В этом году цены на нефть снизились на 22% на фоне того, что добыча нефти из сланцевых пород привела к увеличению объема до максимального за последние 30 лет значения, в то время как спрос на мировом рынке снизился. Десять лет назад цена на нефть была около $50 за баррель. "Нет сомнений в том, что если цены на нефть останутся на том же уровне, что и сейчас, то это приведет к снижению цен на СПГ", – говорит Дэниэл Хайнс, главный аналитик сырьевых рынков в Australia and New Zealand Banking Group.

14 августа 2014, 08:11

Роснефть и санкции

13.08.2014 rbcdaily.ru: Японцы испугались санкций в отношении «Роснефти» «Роснефть» снова почувствовала на себе действие американских санкций: японские компании, крупные покупатели нефти сорта ВСТО, не смогли принять участие в тендерах «Роснефти» на поставку сырья. Банки, испугавшись санкций, отказали им в финансировании сделок. В июле японские покупатели не смогли принять участие в тендерах «Роснефти» по продаже нефти сорта ВСТО с поставкой в сентябре, сообщила вчера The Financial Times со ссылкой на отчет исследовательской компании JBC Energy. Ту же информацию приводит агентство Argus Media: по его данным, одна из японских компаний подтвердила, что не смогла принять участие в тендере «Роснефти» из-за того, что банки отказали в финансировании сделки. В числе потенциальных кредиторов были Credit Agricole, Sumitomo Banking и Bank of Tokyo-Mitsubishi UFJ, пишет Argus. Другие покупатели нефти российской госкомпании также сообщали Argus, что испытывали трудности при получении финансовых гарантий от французского банка BNP Paribas и британского HSBC для покупки нефти у «Роснефти». Представитель «Роснефти» вчера отказался от комментариев, банки на запросы РБК не ответили. Японские потребители — одни из крупнейших клиентов «Роснефти» на восточном направлении. По данным Argus, в июле JX Nippon Oil & Energy, крупнейшей нефтеперерабатывающей компании Японии, было поставлено 125 тыс. барр. ВСТО в день при общем объеме поставок около 500 тыс. барр. JX Nippon Oil & Energy Middle East & Africa на запрос РБК по поводу июльского тендера вчера не ответила. Отказ некоторых японских переработчиков от участия в тендерах «Роснефти» был временным, рассказал РБК вице-президент Argus Media Михаил Перфилов. В последнее время японские банки возобновили кредитование закупок грузов «Роснефти», утверждает он. Санкции против «Роснефти» из-за ситуации на Украине США ввели в июле: компании запрещено привлекать кредиты сроком погашения более 90 дней. Формально ограничения не распространяются на покупателей нефти «Роснефти». Но боязнь нарушить санкции заставляет банки проявлять осторожность. Argus пишет, что и сама «Роснефть» осторожничает. По данным агентства, компания проинструктировала своих клиентов самостоятельно следить за тем, чтобы срок действия всех аккредитивов не превышал 89 дней — на один день меньше «санкционного» лимита. Гораздо сложнее «Роснефти» может прийтись при проведении тендеров по продаже нефти Urals с отгрузкой с октября 2014 года по март 2015‑го. Финансирование таких сделок требует миллиардных платежей, срок погашения кредитов будет превышать лимит в 89 дней, и в условиях санкций предварительное финансирование будет невозможно, отмечает Argus. Похожим образом в случае с «Роснефтью» уже перестраховывались британские банки. В начале июня HSBC и Lloyds Bank отказались финансировать сделку BP с «Роснефтью» по покупке нефти и нефтепродуктов. Британской компании нужен был кредит, чтобы предоставить «Роснефти» предоплату на сумму около $2 млрд. К этому времени санкции были введены только в отношении президента «Роснефти» Игоря Сечина, а не самой компании, но эти два банка все равно решили не участвовать в сделке. Впрочем, меньше чем за месяц партнерам удалось найти других кредиторов, и госкомпания получила предоплату. Аналитики JBC Energy считают, что отказ японских НПЗ от участия в тендерах «Роснефти» может быть одной из причин низкой цены на ВСТО (на прошлой неделе достигла минимума относительно нефти марки Dubai за последние 3,5 года). Если санкции действительно играют свою роль в этом процессе, пишут аналитики, то в ближайшие недели Япония должна будет увеличить объемы закупок как арабской Murban, так и других сортов нефти в атлантическом бассейне, которые должны будут заместить российские в условиях подготовки запасов керосина на зиму.  14.08.2014 Игорь Сечин просит о помощи из-за санкций Как стало известно «Ведомостям», санкции побудили «Роснефть» обратиться за помощью. Компания просит одолжить ей из фонда национального благосостояния 1,5 трлн руб. Президент «Роснефти» Игорь Сечин обратился в правительство с просьбой о финансовой помощи компании, рассказал «Ведомостям» человек из нефтяной отрасли, подтвердили четверо федеральных чиновников и еще один слышал об этом. Это же следует из письма (копия есть у «Ведомостей») от 12 августа замминистра экономического развития Олега Фомичева в Минэнерго. В письме Минэкономразвития по поручению председателя правительства Дмитрия Медведева анализирует предложения Сечина. Представитель правительства от официальных комментариев отказался, запрос в Минэкономразвития остался без ответа. Пресс-служба «Роснефти» комментариев по существу не предоставила. Президент «Роснефти» предлагает пять способов поддержки компании, следует из письма Фомичева. Самый дорогой для государства — выкуп за счет фонда национального благосостояния (ФНБ) новых облигаций «Роснефти» на 1,5 трлн руб. (об остальных мерах поддержки см. статью на стр. 13). Цифру «Ведомостям» подтвердили четыре федеральных чиновника. Необходимость такой помощи Сечин в письме объясняет введенными против компании санкциями США, рассказывают собеседники «Ведомостей» и подтверждается в письме Минэкономразвития. 19 июля минфин США запретил американским компаниям, банкам и гражданам, а также всем, кто ведет операции через США, предоставлять «Роснефти», «Новатэку», Газпромбанку и Внешэкономбанку (ВЭБ) кредиты и займы более чем на 90 дней, а также акционерное финансирование. Хотя санкции, ограничивающие привлечение долгосрочного финансирования, ввели только США, европейские банки и инвесторы де-факто к ним присоединились, потому что многие из них работают на американском рынке и не хотят проблем с властями США, объяснял сотрудник аппарата правительства. Чистый долг «Роснефти» на конец июня составлял как раз 1,5 трлн руб. (около $44,5 млрд). Общий долг нефтяной госкомпании — 2,2 трлн руб., но она получила от CNPC $17 млрд предоплаты за поставку нефти в Китай, а всего получит $70 млрд. Огромный долг образовался у «Роснефти» после покупки в 2013 г. ТНК-ВР за $54 млрд, из которых $44 млрд — наличными. Под ту сделку компания оформила кредиты у пула международных банков на общую сумму в $31 млрд. На этот и следующий годы у «Роснефти» приходится пик выплат по долгам — в сумме около $30 млрд. В конце июля вице-президент по экономике и финансам «Роснефти» Святослав Славинский на телеконференции говорил, что компания чувствует себя уверенно и санкции США ее не волнуют. «С учетом не очень благоприятной конъюнктуры на мировых финансовых рынках компания в любом случае не планировала существенных долгосрочных заимствований в среднесрочной перспективе», — уверял вице-президент «Роснефти». Запрошенных Сечиным денег в ФНБ нет. В июне Медведев подписал постановление, разрешающее Минфину инвестировать в инфраструктурные проекты или держать на депозитах в ВЭБе до 40% средств ФНБ на 1 января 2014 г. и еще до 20% — инвестировать в проекты «Росатома» и Российского фонда прямых инвестиций (РФПИ; по 10% для каждой организации). По данным Минфина, на 1 января в фонде было 2,9 трлн руб., т. е. на инфраструктуру, ВЭБ, «Росатом» и РФПИ должно быть зарезервировано 1,74 трлн руб. Часть денег уже распределена (см. графику на стр. 04). К 1 августа ФНБ увеличился — благодаря ослаблению рубля — до 3,1 трлн, но нужных «Роснефти» 1,5 трлн руб. все равно не набирается. Об этом же сказано в письме Минэкономразвития: необходимый объем средств для поддержания ликвидности «Роснефти» отсутствует. Чиновник финансово-экономического блока правительства, которого «Ведомости» попросили прокомментировать предложение «Роснефти», ограничился одним словом: «Ужас». По словам сотрудника аппарата правительства, Медведев скорее всего не поддержит просьбу Сечина. Государственные и частные компании и банки если и просили до сих пор помощи у государства, то существенно меньше (см. врез на стр. 04). Запрашиваемые «Роснефтью» 1,5 трлн руб. больше суммарных затрат федерального бюджета на здравоохранение, образование и ЖКХ в 2014 г. — на эти статьи отведено 1,244 трлн руб., а также планируемых расходов на эти цели в 2015-2017 гг. — примерно по 1,1 трлн руб. ежегодно. Совокупный размер дорожных фондов, из которых финансируются строительство и реконструкция дорог, составит в 2015 г. 1,16 трлн руб. Расходы федерального бюджета на госпрограмму поддержки сельского хозяйства — те самые 1,5 трлн руб., но деньги будут тратиться частями до 2020 г. Затраты бюджета на развитие присоединенных регионов Крыма составят до 2020 г. 658,1 млрд руб. Аналитик Райффайзенбанка Андрей Полищук полагает, что на фоне ослабления рубля «Роснефть» решила подстраховаться: «Возможно, компания считает, что рублевые облигации будут ей дешевле, чем и дальше выбирать предоплату в долларах от CNPC». Китайская предоплата предполагает начисление процентов (шестимесячный LIBOR + 229 б. п.). Замначальника управления «Велес капитала» Василий Танурков сомневается, что рублевые облигации обойдутся дешевле, чем китайская предоплата. Такое впечатление, продолжает он, что «Роснефти» нужны эти средства «на всякий случай», и можно предположить, что компания хочет продолжить приобретения. По мнению Тануркова, у компании не должно возникнуть никаких проблем с обслуживанием долга даже без денег из ФНБ. Другой аналитик, попросивший об анонимности, не исключает, что у «Роснефти» из-за санкций могли возникнуть проблемы с рефинансированием долга.   «Роснефть» просит помощи из-за санкций-2 Президент «Роснефти» Игорь Сечин просит отдавать нефтяной компании участки на шельфе и суше в адресном порядке и расширить льготы для шельфа Президент «Роснефти» Игорь Сечин предложил правительству меры поддержки «Роснефти» в связи с введенными в июле против компании секторальными санкциями США. Среди них — предоставить «Роснефти» в адресном порядке участки на шельфе и суше «по списку», говорится в заключении статс-секретаря — заместителя министра экономического развития Олега Фомичева в адрес Минэнерго (копия есть у «Ведомостей»). Подлинность документа подтвердил федеральный чиновник. Получить комментарии вчера вечером в Минэнерго и Минприроды не удалось. Представитель Минэкономразвития от комментариев отказался. Представитель «Роснефти» не дал комментариев по существу. Просит ли Сечин о каких-то конкретных участках, непонятно. Предоставление участков недр в пользование оформляется специальным госразрешением в виде лицензии на основе закона «О недрах». Участки на суше распределяются по конкурсу или на аукционе, а на шельфе — только между «Роснефтью» и «Газпромом» без тендера. Замминистра считает, что изменение этого порядка «нецелесообразно». В случае адресного предоставления участков «Роснефти» есть риск «монополизации рынка нефти», что может негативно отразиться на инвестиционном климате в нефтяной отрасли, говорится в заключении. «Роснефть» — крупнейшая нефтяная компания в России, на ее долю приходится почти половина годовой добычи нефти (207 млн т в 2013 г.). Другое предложение Сечина — снять ограничения по сроку применения нулевой ставки экспортной пошлины для шельфовых проектов, отнесенных к 3-й (проекты высокого уровня сложности) и 4-й (арктические проекты) группам сложности. Сейчас льгота действует соответственно до 12 апреля 2037 г. и 31 марта 2042 г. В Минэкономразвития считают, что отмена предельного срока преждевременна. Но к этому вопросу можно вернуться после получения дополнительных геологоразведочных данных. На конец 2013 г. у «Роснефти» 25 участков арктического шельфа. Президент «Роснефти» также просит поддержать строительство Восточного нефтехимического комплекса (ВНХК). Фомичев напоминает, что Минэкономразвития поддержало реализацию проекта, но обратило внимание, что разработка механизма финансирования инфраструктуры к комплексу еще не завершена. «Одновременно с этим было предложено рассмотреть возможность не прямого финансирования проекта за счет бюджетных средств, а через предоставление льгот», — указано в письме. Уже подготовлен проект распоряжения правительства по проекту ВНХК. Он предполагает, что объекты внешней инфраструктуры 1-й и 2-й очереди ВНХК, а также объекты необщего пользования будут на 103,7 млрд руб. профинансированы по ФЦП «Экономическое и социальное развитие Дальнего Востока и Байкальского региона на период до 2025 г.». Ранее источники «Ведомостей» рассказывали, что «Роснефть» для защиты от санкций, ограничивающих поставки в Россию оборудования для нефтедобычи, предложила ввести мораторий на применение закона «О закупках товаров, работ, услуг отдельными видами юридических лиц» и снизить или обнулить пошлины на импортное оборудование. Аналитик «Сбербанк CIB» Валерий Нестеров считает, что в связи с санкциями правительство должно будет изучать ситуацию и выявлять наиболее слабые места в ТЭКе, например в случае снижения добычи нефти. Но вот возможности господдержки бизнеса сейчас сильно ограничены, скорее наоборот, государство хочет получить больше от бизнеса, говорит он. По его словам, просить поддержки для нескорых проектов — разработки шельфа и строительства ВНХК — неактуально и, вероятно, сроки их реализации могут изменяться. «На шельфе это зависит от результатов геологоразведки, а запуск ВНХК — от конъюнктуры рынка. Поэтому, может быть, не стоит спешить с крупными проектами, чтобы не потратить деньги неэффективно», — добавляет Нестеров.  14.08.2014 Санкции США и ЕС могут привести к закату российской нефтяной отрасли Санкции против российских нефтяных компаний дорого обойдутся российскому бюджету из-за падения добычи сырья: отрасль не справится без технологий, прогнозирует Bank of America Merrill Lynch Из-за санкций нефтяная отрасль России может недополучить около $1 трлн инвестиций в следующие 30 лет, прогнозирует Bank of America Merrill Lynch (BofA). Это приведет к пикированию добычи и потерям для бюджета — упущенные доходы могут составить $27-65 млрд до 2020 г. В конце июля США и ЕС ограничили экспорт в Россию оборудования для глубоководного бурения, добычи в Арктике и сланцевой нефти. И без санкций добыча снижалась бы в среднем на 1,5% в год, а из-за эмбарго падение может ускориться до 3-5%, предупреждают аналитики BofA. По прогнозам Международного энергетического агентства (МЭА), средний уровень добычи в России в этом году составит около 10,1 млн баррелей в день. В среднесрочной перспективе санкции могут привести к замораживанию амбициозных проектов, поскольку необходимых технологий и опыта самостоятельной разработки сложных месторождений у российских компаний нет, считает Fitch. Все работающие в России сервисные компании опираются на западные технологии — оборудование и программное обеспечение, предупреждают аналитики Moody’s, из-за санкций придется обращаться к альтернативным поставщикам оборудования из КНР, качество технологий может ухудшиться. В России были запланированы масштабные сейсмические исследования в ближайшие годы, санкции могут изменить планы, признал Инге Рюкке из норвежской инжиниринговой компании Aker Solutions. По данным Минэнерго, зависимость нефтегазового сектора от импорта велика: все оборудование для проектов по разработке шельфовых месторождений и производства СПГ иностранное, в целом для добычи нефти и газа ввозится 24% оборудования. Санкции ограничили и доступ компаний к долгосрочному капиталу, констатируют аналитики BNP Paribas. Между тем традиционные нефтегазовые месторождения, на которых в России добывается около 90% нефти, истощены и добыча на них падает, объясняют аналитики BofA, а для освоения труднодоступных месторождений требуются все более сложные технологии и оборудование. В том числе на шельфе, в Восточной Сибири, для добычи сланцевой нефти. Добыча на арктических месторождениях и сланцевой нефти могла составить 250 000 баррелей в год до 2018 г., подсчитали аналитики Morgan Stanley. По оценке US Geological Survey, запасы сланцевой нефти в баженовской свите превышают 140 млрд баррелей. Прямые инвестиции в новые российские месторождения оценивались примерно в $500 млрд до 2030 г., эти проекты могли привлечь еще $300 млрд инвестиций в российскую экономику, что увеличило бы ее на $3,5 трлн, пишут аналитики BofA. Освоение новых регионов увеличило бы капитализацию нефтегазового сектора на $100-150 млрд (сейчас — $326 млрд, данные Bloomberg), прогнозирует BofA. Но санкции вынудят инвесторов переоценить вложения в Россию, пишет главный экономический советник Allianz Мухаммед эль-Эриан. Крупнейшие проекты по освоению нетрадиционных ресурсов — у «Роснефти», отмечает BofA. Президент «Роснефти» Игорь Сечин говорил в прошлом году, что компании нужно $500 млрд для освоения арктического шельфа, запасы которого превышают 35 млрд баррелей нефтяного эквивалента. Российские компании пока не меняют планы. Значительного влияния на деятельность санкции не оказали и не оказывают, инвестпланы не пересматриваются, заявлял ранее на телеконференции финансовый директор «Газпром нефти» Алексей Янкевич (его слова по «Интерфаксу»). На прошлой неделе «Роснефть» и ExxonMobil начали бурение самой северной скважины в России — «Университетская-1», сообщила «Роснефть».   13.08.2014 Из-за санкций Россия может лишиться $1 трлн — Bank of America Merill Lynch Санкции в отношении российской нефтегазовой отрасли не ударят по текущим производственным показателям, но могут повлиять на развитие ТЭК после 2018 года Санкции Запада на доступ к западным технологиям в ТЭК могут привести к пикированию добычи нефти и выпадению $27-65 млрд бюджетных доходов: отрасль не получит $1 трлн инвестиций, а «Роснефть» лишится главного катализатора роста, считают в Bank of America Merill Lynch. Санкции США и ЕС против российского нефтяного сектора были введены в конце июля, они ограничивают экспорт в Россию оборудования для глубоководного бурения, добычи в Арктике и сланцевой нефти. Традиционные нефтегазовые месторождения в России, которые обеспечивают 90% текущего производства нефти в России, — на стадии снижения: требуется применение все более сложных технологий и оборудования, чтобы поддерживать объемы производства, объясняют аналитики Bank of America Merill Lynch. Кооперация с западными компаниями критична для развития российской нефтегазовой отрасли, предупреждают они. Общие прямые инвестиции в новые российские месторождения оценивались около $500 млрд до 2030 г. и могли бы принести дополнительно не менее $300 млрд за счет эффекта мультипликатора, пишут аналитики Bank of America Merill Lynch. Президент Роснефти Игорь Сечин называл в прошлом году $500 млрд в качестве необходимых инвестиций в освоение арктического шельфа, где запасы составляют более чем 35 млрд барр. нефтяного эквивалента. Средние темпы снижения добычи составят около 1,5% в год, но могут ускорится до 3-5%, предупреждают аналитики Bank of America Merill Lynch. По прогнозам Международного энергетического агентства (МЭА), средний уровень добычи в России в этом году составит около 10,1 млн барр. в день. Ускорение темпов снижения добычи нефти может привести к потере $27-65 млрд бюджетных доходов в ближайшие шесть лет, прогнозируют аналитики Bank of America Merill Lynch. По мере исчерпания традиционных запасов неизбежным становится продвижение на новые территории в Восточной Сибири и офшорные территории, а также освоение сланцевой нефти. Эти запасы являются значительными и могут стать основой будущей добычи нефти в России. По оценке US Geological survey, запасы сланцевой нефти в Баженовской свите превышают 140 млрд барр. По оценке Минэнерго, добыча нетрадиционной нефти может принести более 500 000 барр. в день к 2018 г. Освоение арктического шельфа могло бы повысить капитализацию «Роснефти», но если крупнейшие западные компании из-за санкций начнут ограничивать деятельность в России, сценарий роста привлекательности «Роснефти» в будущем не реализуется — катализатор ее роста исчезнет, считают аналитики Bank of America Merill Lynch. Инвестпрограммы всех российских нефтяных компаний могут сократиться, спрос на нефть из России также может упасть, предупредило МЭА. Санкции Евросоюза являются точечными мерами, они не относятся к уже согласованным контрактам, действуют один год и могут быть продлены только на основе консенсуса в ЕС, оптимистичны в МЭА. Агентство отмечает и мягкость ограничений: они сформулированы расплывчато и оставляют возможность компаниям обойти их. Что будет в случае, если санкции будут действовать продолжительное время, МЭА ответа не дает. Санкции могут повлиять на темпы роста всех российских компаний, признало МЭА ранее: их расходы и инвестпрограммы могут стать более консервативными. Темпы роста российского ТЭКа могут упасть, поскольку введенные санкции ограничили доступ компаний к долгосрочному капиталу и технологиям, полагают аналитики BNP Paribas. В России были запланированы масштабные сейсмические исследования в ближайшие годы, санкции могут изменить планы, признал Инге Рюкке из норвежской инжиниринговой компании Aker Solutions. Российским нефтегазовым компаниям из-за санкций Запада придется обращаться к альтернативным поставщикам оборудования из КНР: сбоев не будет, но качество технологий может ухудшиться, предупредило агентство Moody’s. Но российские компании пока не меняют планы из-за санкций. На прошлой неделе «Роснефть» и ExxonMobil начали бурение самой северной скважины в России «Университетская-1», сообщила «Роснефть». Президент «Роснефти» Игорь Сечин сказал, что надеется открыть в Арктике новую нефтеносную провинцию, которая «по объему ресурсов превзойдет такие нефтегазоносные провинции, как Мексиканский залив, бразильский шельф, шельф Аляски и Канады, и будет сопоставима с ресурсной базой Саудовской Аравии». «Существенного влияния на нашу текущую деятельность санкции не оказали и не оказывают. Но что касается наших инвестиционных планов, мы их тоже не пересматриваем», — заявил в ходе телефонной конференции финансовый директор «Газпром нефти» Алексей Янкевич (его слова по «Интерфаксу»).  12.08.2014 МЭА: Санкции могут снизить расходы российских нефтекомпаний Инвестиционные программы российских нефтяных компаний могут сократиться, спрос на нефть из России также может упасть, считают в Международном энергетическом агентстве Санкции США и ЕС в отношении нефтяного сектора России вряд ли сильно повлияют на уровень добычи страны и ее поставки на внешний рынок в краткосрочной перспективе, заявило Международное энергетическое агентство (МЭА). Как это повлияет в среднесрочной перспективе, пока не ясно, считают в агентстве. США и ЕС ввели санкции против российского нефтяного сектора в конце июля, ограничив экспорт в Россию оборудования для глубоководного бурения, добычи в Арктике и сланцевой нефти. Отношение к российскому ТЭКу среди инвесторов ухудшилось после введения отраслевых санкций со стороны США и ЕС: индекс MSCI Russia Energy упал в июле на 11%. Санкции Евросоюза являются точечными мерами, они не относятся к уже согласованным контрактам, действуют один год и могут быть продлены только на основе консенсуса в ЕС, оптимистичны в МЭА. Агентство отмечает и мягкость ограничений: они сформулированы расплывчато и оставляют возможность компаниям обойти их. Что будет в случае, если санкции будут действовать продолжительное время, МЭА ответ не дает. Но санкции могут повлиять на темпы роста российских компаний, признало МЭА: их расходы и инвестпрограммы могут стать более консервативными. Аналитики BNP Paribas считают, что темпы роста российского ТЭКа могут упасть, поскольку введенные санкции ограничили доступ компаний к долгосрочному капиталу и технологиям. Но российские компании пока не меняют планы. На прошлой неделе «Роснефть» и ExxonMobil начали бурение самой северной скважины в России Университетская-1 участка Восточно-Приновоземельский-1, сообщила «Роснефть». Президент «Роснефти» Игорь Сечин сказал, что надеется открыть в Арктике новую нефтеносную провинцию, которая «по объему ресурсов превзойдет такие нефтегазоносные провинции, как Мексиканский залив, бразильский шельф, шельф Аляски и Канады, и будет сопоставим с ресурсной базой Саудовской Аравии». Из-за санкций может упасть также спрос на российскую нефть на мировом рынке, считают в МЭА: сейчас проблем с обеспечением рынка сырьем нет, найти замену не составляет труда. Из-за санкций нефтяные котировки могут вырасти уже в следующем году, ранее предупреждали аналитики Morgan Stanley. По их подсчетам, баррель нефти может подорожать на $11 уже в 2015 г., так как Россия добавилась в число геополитических рисков нефтяного рынка, а остальных рисков, связанных с Ближним Востоком, меньше пока не стало.  Нефтяные компании справятся с долгами, несмотря на санкции Санкции могут оказаться хоть в чем-то полезными. Особых проблем с рефинансированием долга нефтегазовые компании не ощутят, но зато компании откажутся от дорогостоящих покупок за рубежом В середине июля США ввели санкции против «Роснефти» и «Новатэка». Этим компаниям был закрыт доступ к получению кредитов на срок свыше 90 дней. Но они смогут воспользоваться ранее открытыми долгосрочными кредитными линиями американских банков. Несмотря на то что доступ к краткосрочному кредитованию закрыт, ситуация с долгом остается управляемой для российского нефтегазового сектора, пишут аналитики Bank of America Merrill Lynch в своем обзоре. Геополитический кризис может подтолкнуть компании больше полагаться на финансирование из Азии. «Роснефть» уже получает предоплату от китайской CNPC (общая ее сумма — $70 млрд), подписала меморандум с Sinopec, напоминают эксперты. «Газпром» в рамках контракта на поставку газа в Китай получит от CNPC предоплату в объеме $25 млрд, которые пойдут на строительство газопровода «Сила Сибири». «Новатэк» ждет получения до $20 млрд в качестве проектного финансирования на «Ямал СПГ» (см. статью на 12 стр.). В то же время ни «Газпром», ни «Новатэк» не подтверждают, что они будут использовать предоплату для погашения долга, но у них есть возможность заменить долгосрочный долг предоплатой. Эксперты считают, что положение российских компаний лучше, чем было в кризисном 2008 году. Объем краткосрочного долга в их долговом портфеле упал со среднего значения с 60% в 2008 г. до 30% в 2013 г. А низкая процентная ставка в 2011-2013 гг. стимулировала их к тому, чтобы брать долгосрочные кредиты. Но если компаниям будет отказано и в кредитах на европейском рынке, это может привести к росту расходов на обслуживание долга, заморозить их дальнейшие инвестиции и замедлить рост, писали эксперты Moody’s. Президент «Роснефти» Игорь Сечин не исключал сдвига каких-либо проектов и готов к ситуации, вызванной санкциями США. Изменений в работе с иностранными партнерами не произошло, уверял в пятницу вице-президент «Роснефти» Святослав Славинский. Отношение чистый долг «Роснефти» к EBITDA — 1,3. Но на этот и следующий год приходятся самые высокие выплаты по долгам — в сумме около $30 млрд. При этом капзатраты в первом полугодии составили всего 237 млрд руб. (33% запланированного на 2014 г.). С другой стороны, санкции могут «уменьшить аппетиты» российских компаний к покупкам на внутреннем и зарубежном рынках, считают эксперты Bank of America Merrill Lynch. В июле в интервью Financial Times Славинский говорил, что «Роснефть» меняет стратегию развития и отказывается от новых крупных приобретений в пользу органического роста. Но продолжит совершать «небольшие по размеру» сделки в области бурения и обслуживания. «В любом случае санкции отразились на всех компаниях Это в любом случае отражается на капитализации компании и на ее возможностях доступа к финансовым рынкам, — говорил в июне в интервью “Ведомостям” президент “Лукойла” Вагит Алекперов. — Кто-то может говорить “не отразилось, не отразилось”, но санкции все равно отражаются на всех!» Вчера он сказал, что компания сохраняет планы по реализации инвестиционной программы. По его словам, пока сложно сказать, как повлияют санкции на деятельность компании. «Мы еще дооцениваем все последствия, которые могут сложиться», — сказал он (цитата по «Интерфаксу»). Источник в одной из нефтяных компаний говорит, что основная сложность сейчас — это удорожание привлечения заемных средств. «Мы предпринимаем усилия, чтобы снижать кредитную нагрузку, высвобождать оборотный капитал», — сказал председатель совета директоров ТМК (поставщик труб для нефтегазового сектора) Дмитрий Пумпянский. ТМК хочет сократить инвестиции и направлять высвободившиеся деньги на погашение кредитов, сказал бизнесмен. Проблем с доступом к финансированию не будет даже у «Роснефти», уверен заместитель начальника управления анализа рынка акций ИК «Велес капитал» Василий Танурков. Если будут откладываться проекты, то, скорее всего, по причине отказа от участия иностранных компаний, а также из-за эмбарго ЕС на поставку оборудования в Россию. Но коснутся только проектов на начальной стадии, говорит он.  

14 марта 2014, 23:35

США обвинили 16 банков в махинациях с LIBOR

Финансовые власти США выдвинули обвинения против 16 крупных банков в махинациях с процентной ставкой LIBOR в период 2007 2011 гг.

25 февраля 2014, 12:21

JP Morgan продолжит сокращать сотрудников

Крупнейший финансовый конгломерат JPMorgan Chase & Co. собирается сократить персонал в подразделениях, специализирующихся на ипотеке, сообщает The Financial Times.

24 января 2014, 08:14

Под чьим контролем глобальная фин.система?

Не стоит лишний раз теребить рану на Украине, по крайней мере, до поступления новых разведданных. Нефин.сектор достаточно рассмотрел, но что там с банками? Активы публичных банков и инвестиционных фондов планеты (2110 фин.организации) составляют по оценочным данным около 109.2 трлн долл, из которых 90 трлн (82%) приходится на первые 150 банка. 50 самых крупных фин.организаций держат 67 трлн, а первые 25 почти 50 трлн по данным за 2012 год. Здесь не учитываются страховые, пенсионные, ипотечные, взаимные, денежные, хэдж фонды и гос.фонды. И еще. Здесь не учитываются деривативы и забалансовые активы коммерческих банков, что весьма мощно развито в США. Только банки и инвест.банки по данным из корп.отчетов. Вот собственно под чьим контролем глобальная фин.система - крупнейшие банки и инвестфонды с активами свыше 500 млрд на 3 квартал 2013.  Самый крупный банк в мире находится в Китае - Industrial and Commercial Bank of China – уже более 3 трлн долларов активов. Для сравнения наш мега монстр Сбер всего 515 млрд долларов и в конце списка. Удивляет нашествие китайских банков? Ну-ну ) Сейчас 4 китайских банка превзошли таких гигантов, как Citi и Bank of America. Получается, что всего 1% публичных банков держит до половины всех активов глобальной фин.системы. Сейчас в мире 242 банка и инвест.фонда с активами более 50 млрд, 145 с активами более 100 млрд, всего 50 с активами более 500 млрд и 25 банков с активами свыше 1 трлн. Из этих 109 трлн около 62 трлн сосредоточено в 5 странах (США, Китай, Япония, Англия и Франция).  Мои расчеты по США - 16.6 трлн (624 организации) по всем и 12.3 трлн только по коммерческим банкам отчасти совпадают с расчетами ФРС из Z1 http://www.federalreserve.gov/apps/FOF/Guide/P_76_coded.pdf Однако, следует понимать, что говоря о США в расчетах я имею в виду банки, имеющие американскую нац.принадлежность, а сами эти активы распределены по всему миру в различных фин.инструментах, т.е. далеко не только в США. Но из этого выходит, что американские банки не столь огромные по сравнению с тем, насколько выросли китайские? На истории это смотрится еще более невероятно.  В 2007 китайские банки имели немногим более 4 трлн активов и выросли с тех пор в 2.5 раза(!) В 2009 обогнали французские и английские, в прошлом году превзошли японские и в этом году обойдут американские! Всего за один год китайские банки «рожают» больше активов, чем все развитые страны вместе взятые. Активы банков БРИК выросли с 6 трлн в 2007 до 17 трлн в 2013 (!) 11 трлн за 6 лет! Активы Франции, Англии, Германии, Испании, Италии, Швейцарии, Швеции, Нидерландов, Дании, Австрии, Норвегии, Греции, Португалии и Бельгии в совокупности в 2007 были 32.7 трлн долл, а в 2013 32.2 трлн, т.е. упали на пол триллиона. В таблице выборка по ТОП 500 мировых банков и инвест.банков для 30 крупнейших стран.  Но это были данные в долларах, где динамика может искажаться из-за валютного курса. Теперь в нац.валюте, процентное отношение к 2007.  Из 30 крупнейших стран наибольший процентный прирост по отношению к 2007 по настоящий момент в России – в 3.5 раза активы выросли, потом Индия (в 3 раза), в 2.8 раза увеличились активы в Турции, в 2.6 раза – Бразилия и в 2.5 раза у китайских банков. Все в нац.валюте. Сократились в Германии (-3%), Нидерланды (-14%), Бельгия (-30%) Швейцария (-35%). Интересно, что активы греческих банков выросли во многом из-за переоценки активов по причине мощного роста облигаций в 2013 и рекапитализации. Рост активов в США и Японии почти полностью за счет ФРС и Банк Японии, но причем рост активов значительно меньше, чем влили денег. Куда ушли деньги от QE – более 5 трлн, которые раздали банкам? А черт его знает. Основной поток QE ушел в различные забалансовые схемы через ряд жульнических махинаций. Часть на компенсацию убытков, часть на выкуп акций, которые прямым образом не отобразили в балансах. Много мути. ДОП. Из расчета в таблицах выпала Австралия, Ирландия и Южная Африка. Как нибудь потом добавлю. Первичные данные из Eikon 

23 декабря 2013, 21:07

Официальная и тайная истории ФРС

Сто лет назад, 23 декабря 1913 года, в США была создана Федеральная Резервная система (ФРС) — «частный печатный станок» планетарного масштаба для производства денег в неограниченном количестве. Испокон веков главным средством расчетов между людьми были драгметаллы, оформленные в виде дензнаков — монет или мерных слитков. Отсутствие золота и серебра всегда становилось причиной экономического упадка. Малая денежная масса диктовала соответствующий объем производства. Напротив, когда в экономику поступало большое количество драгметаллов, все расцветало. Открыли Америку, в Старый Свет поплыли галеоны с золотом и серебром — начался экономический бум. Правда, не везде. В XVII веке Англия, в отличие от Испании, еще не имела обширных колоний, поэтому госбюджет острова пребывал в перманентном дефиците. Между тем войны — прежде всего с Францией — требовали колоссальных денег. На помощь властям пришли ростовщики. В 1694 году был создан Банк Англии. Его соучредителями стали, с одной стороны, частные финансисты, с другой, «корона». Декларировалось, что под золото и серебро, находящееся в его хранилищах, выпускаются дензнаки. И их можно в любой момент обменять на звонкий металл. Удобно. Кто проконтролирует, какое именно количество ресурсов лежит в закромах? То есть можно напечатать столько банкнот, сколько захочется. Англичане не скрывают статус своего эмиссионного центра, всю информацию о том, что он частный, можно найти на www.bankofengland.co.uk. А про то, как Великобритания, стоящая на пороге финансового кризиса, внезапно напечатала много денег, за счет чего выиграла войну с Францией и Испанией, можно прочитать в книгах основателя геополитики контр-адмирала Альфреда Мэхэна. Великобритания начала активно строить империю. Кубышка Банка Англии стала пополняться, необходимость выпускать обязательств больше, чем было резервов в наличии, отпала. Тем не менее возник прецедент, а вместе с ним во власть попали и финансисты. Барон Натан Ротшильд, Дизраэли, лорд Биконсфилд — как раз люди из банковской среды. Но патриархальное и весьма консервативное английское общество с его сильной влиятельной аристократией не давало возможности ростовщикам развернуться в полную силу. А вот в США аристократии не было, бессословное общество сулило отличные шансы для установления власти денег. Первый банк Соединённых Штатов, Филадельфия (штат Пенсильвания)   А как это было в США ?  Центральный банк США — Федеральная Резервная Система (ФРC) — был создан намного позднее, чем центральные банки иных стран Запада. В США и ранее действовали структуры, фактически выполнявшие подобные функции. Первым учреждением такого рода в 1791 году стал First Bank of the United States. First Bank («Первый Банк») базировался во временной столице США — Филадельфии и был создан по предложению известного политика Александра ГамильтонаAlexander Hamilton, чтобы решить проблему огромного государственного долга, образовавшегося в результате Войны за Независимость и для создания национальной валюты США. Уильям ГрейдерWilliam Greider, автор книги «Секреты Храма»Secrets of the Temple, посвященной истории Федеральной Резервной Системы, отмечает, что сама идея создания подобного органа вызвала немало споров. К примеру, госсекретарь США Томас ДжефферсонThomas Jefferson считал, что образование такого учреждения противоречит Конституции, поскольку государство не имеет права вести бизнес и, таким образом, нарушает традиционные законы о собственности и свободе предпринимательства. Гамильтон, в свою очередь, считал данное учреждение эффективным средством для решения государственных задач.     First Bank должен был проработать 20 лет, за которые требовалось создать надежную финансовую систему, государственный золотой резерв, обеспечить стабильность банковской деятельности и эмитировать национальную валюту США. First Bank был частично государственным, однако большая часть его активов принадлежала частным лицам и компаниям. First Bank в 1811 году прекратил свою деятельность после того, как Конгресс отказался продлить мандат на его существование. Основной причиной этого были подозрения, что банк действовал прежде всего в личных интересах акционеров, а не в интересах государства. Однако ситуация в стране не улучшилась. Алан МелтцерAlan Meltzer, автор книги «История Федерального Резерва»A History of the Federal Reserve, подчеркивает, что в ту пору банковская и кредитная деятельность не регулировалась, многие банки самостоятельно печатали долларовые банкноты, за количеством, качеством и курсами которых никто не следил, в одних районах США ощущался переизбыток денег, а в других — недостаток и т.д. Централизация финансов была очевидна очень многим, однако американцы продолжали испытывать предубеждение к подобным структурам, считая, что они, в первую очередь предназначены для обмана населения и обогащения власть имущих (европейский опыт того времени давал много поводов для появления подобных подозрений). В 1816 году функции центробанка были переданы Second Bank of the United States («Второй Банк»). Этот шаг был сделан в надежде хоть как-то стабилизировать доллар. Second Bank так же, как и First Bank, был создан на 20 лет и принадлежал, в основном, частным инвесторам (американское государство тогда страдало от хронического дефицита бюджета) и тоже был ультрацентрализованным учреждением. Тогдашний президент США Эндрю ДжексонAndrew Jackson назвал это учреждение «концентрацией власти в руках небольшой группы людей, не несущих ответственности перед народом». Second Bank действительно стал скандальным предприятием. Председатель банка Уильям ДжонсWilliam Jones, близкий друг президента Джеймса МэдисонаJames Madison, уделял основное внимание политике, пренебрегая финансовой стабилизацией. Джонс выдавал «политические» кредиты и не требовал их погашения. Деятельность филиалов банка не поддавались контролю, в результате чего вся банковская система США оказалась в ситуации полнейшего хаоса. В то время Соединенные Штаты переживали экономический бум. Европа, обессиленная наполеоновскими войнами, крайне нуждалась в поставках американского зерна. В этот период спекуляции, связанные с куплей-продажей земельных участков, всячески поощрялись финансовыми институтами страны. Дело дошло до того, что практически каждый желающий мог получить банковскую ссуду и начать спекулировать землей. Тем не менее, в 1818 году управляющие Second Bank осознали, что переборщили с кредитами и внезапно потребовали у заемщиков возврата средств. В итоге, объемы купли-продажи земли резко сократились. В свою очередь, Европа, восстановившая сельское хозяйство, сократила экспорт американского зерна. Все это стало причиной «Паники 1819 года» — фактически первым серьезным финансовым кризисом в истории США. К 1836 году, по истечении 20-летнего срока, Second Bank прекратил свое существование, после чего наступила эра полной банковской свободы — в США просто отсутствовала организация, выполнявшая функции Центрального Банка. В период с 1862 по 1913 год за проведение государственной финансовой политики отвечали уполномоченные частные банки, а Конгресс США пытался издавать законы, которые, зачастую, лишь ухудшали ситуацию.   Частный курорт Моргана на острове Джекилл, где происходили встречи организаторов ФРС   Местом рождения Федеральной Резервной Системы США стал остров Джекил, расположенный в штате Джорджия. В 1886 году группа миллионеров купила этот остров и превратила его в закрытый клуб, где было модно проводить зимы. В 1900 году на острове отдыхали семьи, в руках которых была сосредоточена шестая часть денег планеты — Асторы, Вандербильты, Морганы, Пулитцеры, Гулды и другие. Показательно, что попасть на остров Джекил могли только люди, входившие в состав клуба. Клубмены отказались допустить на свой курорт молодого британского офицера из очень родовитой семьи Уинстона Черчилля Winston Churchill (будущий премьер-министр Великобритании) и известного политика, будущего президента США Уильяма Маккинли William McKinley. На пике популярности острова Джекил в США начались дебаты о создании системы централизованного управления финансовой деятельностью. Причиной этого стали четыре крупных финансовые кризиса, потрясшие США в период с 1873 по 1907 годы. Американцы тогда крайне негативно относились к самой идее создания центрального банка. Аналогичные структуры в Европе действовали неэффективно и даже деструктивно. Кроме того, европейские центральные банки позволяли правительствам практически бесконтрольно тратить бюджетные средства. Через год после кризиса 1907 года (принято считать, что его «организатором» был один из «курортников» Джон Морган J.P.Morgan), Конгрессом США была создана Национальная Денежная Комиссия National Monetary Commission, которая должна была выяснить причину нестабильности банковской системы США. Историк Дон АлленDon Allen, автор книги «Директора Федерального Резерва: Исследование Корпоративного и Банковского Влияния»Federal Reserve Directors: A Study of Corporate and Banking Influence, пишет, что в 1910 году была создана другая группа, в которую вошли руководители крупнейших корпораций и банков США. Они тайно встречались на острове Джекил, где и разрабатывали концепцию органа, который должен был превратиться в Федеральную Резервную Систему. Известно даже имя человека, который создал концепцию центрального банка США — Пол ВарбургPaul Warburg, высокопоставленный руководитель банка Kuhn, Loeb and Co, член «клана Ротшильдов». Варбург предложил простой план. Во-первых, центральный банк не должен был называться «центральным банком», поскольку американцы негативно относятся к передаче рычагов управления финансами одной госструктуре. Во-вторых, центральный банк должен контролироваться Конгрессом, однако большинство его управляющих должно назначаться частными банками, которые также будут владеть его акциями. В-третьих, была предложена система, согласно которой в США образовывался не один, а целых 12 федеральных банков. Помимо всего прочего, причиной было желание не создать впечатления, что центральный банк контролируется «акулами Уолл-Стрита», точнее финансовыми королями Нью-Йорка. Учитывались также значительные размеры территории США и наличие бесчисленного количества частных банков, действовавших практически бесконтрольно. В 1912 году Национальная Денежная Комиссия опубликовала доклад, в котором рекомендовалось создать в США центральный банк. Эдвард ГриффинEdward Griffin, автор книги «Творение Острова Джекил «The Creature from Jekyll Island: A second look at the Federal Reserve отмечает, что большинство ее рекомендаций было основано на идеях Варбурга. В 1913 году Конгресс США принял Закон Оуэна-Гласса Owen-Glass Act, иначе называемый Законом о Федеральной Резервной СистемеFederal Reserve Act, согласно которому и была создана Федеральная Резервная Система. Закон был подписан президентом Вудро ВильсономWoodrow Wilson 23 декабря 1913 года и немедленно вступил в силу. Показательно, что Федеральный Резервный Банк Нью-Йорка — города, где была сконцентрирована львиная доля капитала США — получил определенные преференции. Впоследствии были приняты и иные законы, регулировавшие деятельность ФРС, например, Закон о Банковской ДеятельностиBanking Act (1935 год), Закон о ЗанятостиEmployment Act (1946 год), Закон о Банковских ХолдингахBank Holding Company Act ( 1956 год), Закон о Международной Банковской ДеятельностиInternational Banking Act и Закон о Полной Занятости и Сбалансированном РостеFull Employment and Balanced Growth Act (1978 год), Закон о Дерегуляции Депозитарных Учреждений и Денежного КонтроляDepository Institutions Deregulation and Monetary Control Act (1980 год), Закон о Реформе Финансовых Учреждений и о Восстановлении их ДеятельностиFinancial Institutions Reform, Recovery, and Enforcement Act (1989 год), Закон о Совершенствовании Деятельности Федеральной Корпорации Страхования ДепозитовFederal Deposit Insurance Corporation Improvement Act (1991 год) и т.д.. Клуб на острове Джекил был закрыт в 1942 году. Пятью годами спустя остров приобрел штат Джорджия. Ныне это туристический объект — в одном из старых отелей до сих пор показывают две комнаты, носящие название Federal Reserve. Структура ФРС Федеральная Резервная Система - парадоксальная структура. Несмотря на то, что она является государственной организацией, де-факто, ее собственниками являются частные лица. ФРС состоит из трех частей: центрального Совета УправляющихBoard of Governors который находится в Вашингтоне, 12-ти Федеральных Резервных Банков, разбросанных по США, и Комитета по Операциям на Открытом РынкеFederal Open Market Committee. Федеральные банки В техническом смысле, каждый из 12-ти федеральных резервных банков является не государственной организаций, а корпорацией (эти банки находятся в крупных городах - Бостоне, Нью-Йорке, Филадельфии, Кливленде, Ричмонде, Атланте, Чикаго, Сент-Луисе, Миннеаполисе, Канзас-Сити, Далласе иСан-Франциско). Их акционерами являются обычные коммерческие банки. Данная система существует с момента образования ФРС в 1913 году и, как указано в соответствующем законеFederal Reserve Act, призвана обеспечить "гибкость и мощь национальной финансовой системы". Всем банкам, ведшим операции на всей территории США, было предписано присоединиться к ФРС, локальные банки могли сделать то же самое по своей инициативе. Это было сделано для того, чтобы центральный банк не стал "башней из слоновой кости", в котором работают исключительно чиновники, решающие свои личные задачи, не обращая внимания на реальную ситуацию в стране. В свою очередь, это постоянно порождает слухи о том, что центральный банк США находится в руках и под фактическим управлением частных лиц, имеющих свои личные материальные интересы (например, эту теорию доказывает Мюррей РотбардMurray Rothbard, автор книги "Дело Против ФРС"The Case Against the Fed). Тем не менее, существуют значительные различия между коммерческими и федеральными резервными банками. Федеральные Резервные Банки проводят операции, не имея целью получение прибыли. Коммерческие банки-акционеры, в отличии от обычных пайщиков, получают весьма незначительные дивиденды (не более 6% годовых) от деятельности федеральных резервных банков, а основной доход получает государство. Фактически эти дивиденды являются платой за использование финансовых активов коммерческих банков. Дело в том, что законодательство США предусматривает, что банки обязаны создавать резервные фонды, которые они в большинстве случаев держат именно в федеральных резервных банках, которые, в свою очередь, могут использовать их при проведении своих операций. Коммерческие банки-акционеры также не имеют права голоса при принятии решений федеральными банками, их паи нельзя продавать и использовать в качестве залога. В 1982 году в апелляционном суде рассматривалось прецедентное дело - частное лицо потребовало у одного из Федеральных Резервных Банков возмещения убытков, нанесенных ему государством. Суд вынес следующий вердикт: "Федеральные резервные банки - не государственные структуры, а независимые корпорации, принадлежащие частным лицам и контролируемые на местном уровне. Федеральные резервные банки были созданы для выполнения ряда государственных задач". Ныне, на волне глобального финансового кризиса, в США вновь усилились позиции политиков, которые предлагают упразднить частно-государственную форму ФРС, превратив ее в полноценный государственный банк. Кроме этого предлагается уменьшить автономию этой структуры, переведя ее в подчинение Министерства Финансов. Однако до реальных шагов в этом направлении дело пока не дошло.   Сколько долларов печатает ФРС.  Программа «количественного смягчения» экономики «QE 1» (quantitative easing) была начата Федеральным Резервом США в разгар мирового финансового кризиса (в ноябре 2008г.) и продолжалась по 2009г. включительно. «QE 1» имела своей целью спасение крупных корпораций, банков и частных предприятий путем выкупа их обесценившихся долгов. За время действия программы ФРС выкупила ипотечных и других облигаций на сумму 1,7 трлн. долларов.  «QE 2» была объявлена ФРС США 2 ноября 2010г. и предполагала покупку казначейских облигаций на сумму 600 млрд. долларов в течение 8 месяцев – по 75 млрд. в месяц. Кроме того, ФРС должна была реинвестировать около 300 млрд. долларов из первой программы количественного смягчения («QE 1»). В итоге общий объём QE2 должен был составить около 900 млрд. долларов. Закончилась в июне 2011г. 13 сентября 2012г. Федеральный Резерв США запустил  третью по счету программу количественного смягчения (QE3). Снова был включен печатный станок, а “напечатанные” доллары пущены на покупку облигаций. Программа выглядит скромнее предыдущих – ежемесячно планировалось выкупать (печатать доллар) ипотечные облигации на сумму 40 млрд. долларов. Ее продолжительность изначально была определена как “несколько кварталов”, но конкретных сроков не устанавливалось. Федрезервом неоднократно подчеркивалось, что главным критерием будет являться общее состояние экономики США – как только ФРС убедится в ее устойчивом и высоком росте, QE3 должна быть свернута.     Конечно же тут не обходится без ТЕОРИИ ЗАГОВОРОВ !  Лоббированием закона о Федеральном резерве (Federal Reserve Act) в парламенте занимался сенатор-республиканец Нельсон Олдрич, тесть Джона Рокфеллера. К сожалению, с первого раза в 1912 году ему не удалось протолкнуть заветный документ под названием «План Олдрича». Впоследствии реформаторы убрали из названия раздражающее демократов имя республиканца Олдрича, внесли в документ ряд незначительных изменений и вновь запустили его уже в качестве инициативы демократов. Таким образом, после изощренных манипуляций банковского круга в 1913 году закон о Федеральном резерве был благополучно ратифицирован. Интересно, что голосование в верхней палате Конгресса имело место 23 декабря, и накануне Рождества в зале заседания сенаторов было совсем немного. Так родилась «гидра ФРС», которая выполняет функции Центробанка с небольшой оговоркой. Форма капитала ФРС является частной — акционерной. Структура этой корпорации состоит из 12 федеральных резервных банков и многочисленных частных банков. Последние являются акционерами ФРС и получают фиксированные 6% годовых в виде дивидендов на свои членские взносы, независимо от дохода Федерального резерва. В настоящее время в этой структуре задействовано около 38% всех банков и кредитных союзов на территории США (примерно 5,6 тыс. юридических лиц). Акции ФРС не дают права контроля, они не могут быть проданы или заложены. Более того, их приобретение является официальной обязанностью каждого банка-члена вложить в них сумму, равную 3% их капитала. Основное преимущество от статуса банка-члена — это займы в резервных банках ФРС. О том, каким структурам в действительности принадлежит Федрезерв США, не известно никому. Лишь тесные дружеские и семейные связи всех глав ФРС с Ротшильдами и Рокфеллерами, а также история создания Федрезерва указывает на них как на истинных владельцев. Однако в 70х годах прошлого века в прессу просочилась некая информация через журналиста-исследователя Роба Керби, который обнародовал список организаций — владельцев ФРС. Впрочем, все эти банки уже давно скрылись путем слияния или поглощения с другими. Все, кроме одного — Bank of England (Bank of London).   Rothschild Bank of London Warburg Bank of Hamburg Rothschild Bank of Berlin Lehman Brothers of New York Lazard Brothers of Paris Kuhn Loeb Bank of New York Israel Moses Seif Banks of Italy Goldman Sachs of New York Warburg Bank of Amsterdam Chase Manhattan Bank of New York   Итак, с одной стороны, богатые семьи Америки существуют и процветают целые столетия, с другой — посредством ФРС они оказывают влияние как на сами Соединенные Штаты, так и на другие страны, потому что доллар по-прежнему остается основной резервной валютой. Кроме того, при необходимости правительство США всегда может занять у ФРС, например, $5 трлн на маленькую победоносную войну на Ближнем Востоке, если интересы сторон совпадают. Начиная с прихода к власти Буша эта мера использовалась настолько часто, что сегодня госдолг составляет рекордные $1,5 трлн. Одновременно стоит сказать, что долги частных лиц и корпораций США составляют более $10 трлн и общая сумма долга приближается к объему ВВП США $13 трлн. Россия накануне дефолта 1998 года находилась в более мягких условиях. Поэтому одной из самых больших проблем текущего кризиса считается угроза дефолта США либо гиперинфляция доллара, если ФРС начнет печатать бумагу с портретами президентов ускоренными темпами. «…Все, в общем, понимают, что причины, которые осенью 2008 года привели к кризису, никуда не делись и что второй удар финансово-экономической стихии неизбежен. При этом свои свободные средства государства и корпорации заметно исчерпали… Остается только один сценарий — государственный дефолт. Проектное и управляемое обрушение доллара», — пишет в одной из публикаций руководитель аналитической группы «Конструирование будущего» Сергей Переслегин. Каким образом произойдет разрядка, остается только гадать. Мир за последние 20 лет существенно преобразился. Еще в середине 1980х годов американцам удалось заставить Японию укрепить иену к доллару, что было выгодно США, но привело к депрессии в Стране восходящего солнца. Сегодня существует растущий не по дням, а по часам Китай со своими представлениями о добре и зле, а если смотреть шире — страны БРИК (Бразилия, Россия, Индия, Китай) — изобретение семьи Голдманов и Саксов. Китай уже сам готов претендовать на то, что юань станет резервной валютой в Азии, Россия стремится взять под свою опеку финансовые системы стран СНГ. При этом в прессе регулярно циркулируют слухи о новой американской валюте. А сколько лет США борется с «золотым долларом» ? А на пороге уже биткоин и как недавно выяснилось самыми крупными кошельками в мире располагает ФБР ! Готовы ли могущественные семьи поделиться властью над печатным станком с соседями? Скорее всего, общечеловеческие принципы для прогнозов здесь неприменимы.   Секретные программы ФРС   Первый в истории существования ФРС аудит, проведенный в 2012 г., показал, что во время и после кризиса 2008 года эта частная корпорация секретно эмитировала и раздала 16 триллионов долларов «своим» банкам. Среди получателей – Goldman Sachs – 814 млрд, Merrill Lynch– 2 трлн., City Group – 2,5 трлн, Morgan Stanley – 2 трлн, Bank of America – 1,3 трлн, The Royal Bank of Scotland и Deutsche Bank получили по 500 млрд. Обращает на себя внимание тот факт, что среди получателей финансирования присутствуют и иностранные банки, что категорически запрещено американским законодательством. Фактически, это нарушение всех правил, а попросту – фальшивомонетничество. Частные инвесторы Федрезерва выпускают в свет неучтенные доллары для реализации собственных интересов. А бесконтрольная эмиссия может привести не только к галопирующей инфляции внутри самих США, но и к потере долларом статуса мировой резервной валюты. Однако главной опасностью для Америки является то, что самоуправство ФРС, раздающей направо и налево ничем не обеспеченные доллары, делает должником именно американское государство, которое и будет нести ответственность перед кредиторами из Китая, Японии, России и ЕС всем своим имуществом. По сути, страна уже не принадлежит ни правительству, ни народу, поскольку долговые обязательства США многократно превысили размеры национального богатства страны.   Почему убили Кеннеди ?  С первого дня появления  схемы Федерального резерва (бесконтрольной эмиссии доллара) представители американского общества отдавали себе отчет в опасности передачи частному банкирскому картелю этой важнейшей функции государства. В 1923 г. Ч.Линдберг, республиканец из Миннесоты, сказал буквально следующее: «Финансовая система США передана в руки Совета директоров Федерального резерва. Это частная корпорация, созданная исключительно в целях извлечения максимальной прибыли от использования чужих денег». Еще более резкой критике подверг ФРС председатель Банковского комитета Конгресса США во времена Великой депрессии Л.Макфедден: «В этой стране создана одна из самых коррумпированных в мире организаций. Она пустила по миру народ США и практически обанкротила правительство. К таким результатам привела коррумпированная политика денежных мешков, контролирующих Федеральный резерв». Сенатор Л.Бейтс добавляет: «Федеральный резерв не является частью правительства США, но обладает большей властью, чем Президент, Конгресс и суды, вместе взятые. Эта организация определяет, какой должна быть прибыль юридических и частных лиц, находящихся в юрисдикции США, распоряжается внутренними и международными платежами страны, является крупнейшим и единственным кредитором правительства. А заемщик обычно пляшет под дудку кредитора». «Отцы» американской демократии тоже видели потенциальные угрозы, исходящие от банковской системы. Автор Конституции США Д.Мэдисон говорил: «История доказывает, что менялы используют любые способы злоупотреблений, заговоров, обмана и насилия для того, чтобы сохранять контроль над правительством, управляя денежными потоками и денежной эмиссией страны».     Долгие годы нападки на ФРС были не только безрезультатны, но и опасны, т.к. являлись лучшим способом испортить себе карьеру или расстаться с жизнью (как вы думаете, почему убили Президента Кеннеди?). Первый успех был достигнут лишь в 2012 г., когда Конгресс США 25 июля 327 голосами «за» и 98 – «против» принял законопроект Рона Пола об аудите Федерального резерва. Законопроект предусматривает полный аудит ФРС, включая проверку соответствия статуса этого института американской конституции. Для этого понадобился кризис, поставивший американское государство на грань выживания. Кому принадлежат доллары ?  Американское государство не имеет собственных денег. Чтобы приобрести свою «национальную валюту», правительство США выпускает облигации, ФРС печатает банкноты и дает их в долг государству путем покупки его облигаций. Далее государство выкупает свои облигации, а деньги с процентами возвращает ФРС. Таким образом, главной статьей дохода ФРС является сеньораж – разница между номиналом денежных знаков и себестоимостью их изготовления. Скажем, если себестоимость изготовления стодолларовой банкноты составляет 10 центов, то сеньораж при выпуске такой бумажки — 99 долларов 90 центов. ФРС получает прибыль не только от продажи долларовых банкнот правительству США, но и от процентных выплат по облигациям казначейства, доходов от платежных операций, депозитов, операций с ценными бумагами. В соответствии с законом «О Федеральном резерве США», ФРС является государственной структурой с частными компонентами, в которую входят: назначаемый президентом США Совет управляющих ФРС, Федеральный комитет по открытому рынку, 12 региональных федеральных резервных банков, частные банки, получающие неотчуждаемые, фиксированной доходности акции федеральных резервных банков в обмен на вносимый резервный капитал, ряд консультационных советов. На самом же деле государство имеет очень ограниченное влияние на деятельность ФРС по ряду причин. Во-первых, ФРС – это государство в государстве и находится вне надзора (как, собственно, и вся банковская система). Во-вторых, управляющие ФРС назначаются сроком на 14 лет с правом продления полномочий. Как известно, Президент США избирается сроком на 4 года, а максимальный срок его пребывания в должности составляет 8 лет. Как говорится, Президенты приходят и уходят, а рулевые ФРС остаются. Предыдущий руководитель ФРС А.Гринспен занимал пост в течение 19 лет, а нынешний председатель Б.Бернанке трудится уже с 2006 г., пережив двух Президентов. В-третьих, ФРС является высшей инстанцией, которая может определить подлинность долларовых банкнот. Это дает не только возможности неконтролируемой эмиссии, но и позволяет признать любые денежные знаки фальшивыми, даже если они на самом деле выпущены самой ФРС США. И, наконец, самое интересное. Федеральный резерв запрещает государству печатать деньги и проводить собственную финансовую политику, независимую от банков. Американские деньги принадлежат ФРС. Поэтому власть сосредоточена именно здесь, а не в Белом доме.   [источники]источники http://www.expforex.com/index/usa_fed_federal_reserve/0-31 http://www.bestreferat.ru/referat-33516.html http://global-finances.ru/frs-ssha-kolichestvennoe-smyagchenie-e/ http://www.orator.ru/stories_pro_federalnuyu.html http://portal-kultura.ru/articles/history/22515-kapitalisty-morgan-dal-prikaz/    Напомню вам еще одну глобальную   Теория заговоров: От Медичи к Ротшильдам или например О «бомбе», которую взорвал Китай 20 ноября 2013 года. А может быть вы еще не знаете Как устанавливается цена на золото в мире ?  Оригинал статьи находится на сайте ИнфоГлаз.рф Ссылка на статью, с которой сделана эта копия - http://infoglaz.ru/?p=39887

23 декабря 2013, 08:00

vedomosti.ru: Схемы «Сургутнефтегаза»

02.10.2013 У «Сургутнефтегаза», возможно, появился новый акционер Сеть фирм, возможно владеющих акциями «Сургутнефтегаза», вышла за пределы России — в ней обнаружилось кольцо из кипрских компаний. Не исключено, что это связано с появлением нового миноритария Структура собственности третьей по добыче нефтяной компании в России — «Сургутнефтегаза» сложна и непрозрачна. В 2007 г. «Ведомости» обнаружили целую сеть из 23 фирм, некоммерческих партнерств и фондов, связанных с «Сургутнефтегазом» — либо учрежденных им, либо управляемых его менеджерами, включая его гендиректора Владимира Богданова. Общие финансовые вложения этих организаций на конец 2005 г. достигали почти 1 трлн руб., а стоимость этих вложений менялась пропорционально капитализации «Сургутнефтегаза» (см. врез). Эксперты сделали вывод: этим структурам могут принадлежать 72% акций «Сургутнефтегаза». Сейчас размер финансовых вложений раскрывают не все эти структуры; у тех, кто это делает, за 2012 г. он составил 568,717 млрд руб.  До недавних пор учредители большинства НП находились в пределах России. Но примерно два года назад ситуация стала меняться: учредители двух некоммерческих партнерств, которые предположительно имеют на балансе 9,26% акций «Сургутнефтегаза», — НП «Рувер» и НП «Нордик» теперь связаны с кипрскими компаниями. А именно — с семью фирмами: Ntarino Investments, Corouna Investments, Cebina Trading, Poleria Trading, Ourako Trading, Mazouna Holdings и Makola Holdings. Они образуют кольцо: первая фирма владеет 100% второй, вторая — третьей и т. д., а последняя — первой (в российском кольце, которое «Ведомости» обнаружили в 2007 г., каждая из фирм владеет каждой; см. схему на стр. 13). Кипрское кольцо появилось среди возможных владельцев акций «Сургутнефтегаза» так. В марте 2011 г. Makola получила 4,76% в ООО «Тольдо», которое владеет 4,76% в ООО «Силладес» — учредителе НП «Рувер», созданного в 2012 г. Долгосрочные вложения этого партнерства за прошлый год превысили 46 млрд руб. Тогда же кипрская Cebina получила 4,76% ООО «Полюсинвест», которое владеет 4,76% в ООО «СПЭС-вега» — учредителе НП «Нордик». Его долгосрочные вложения превысили в прошлом году 43 млрд руб. Новые некоммерческие партнерства — наследники старых. НП «Рувер» было образовано в результате слияния в 2011 г. НП «Бэнф» и НП «Руверпарт», а НП «Нордик» — в результате слияния НП «Диктенпарт» и «Норквей». За исключением этих изменений, сеть из организаций и их российских компаний-учредителей, связанная с «Сургутнефтегазом», продолжает существовать почти в том же виде, что и в 2007 г. Некоторые НП, у которых на балансе могут быть акции компании, при регистрации указали телефон управления методологии «Сургутнефтегаза». В других партнерствах, например НП «Фиренц» и НП «Эккон», директорами по-прежнему являются сотрудники НПФ «Сургутнефтегаз» — заместитель директора фонда Алексей Назаров и начальник юротдела Валерий Ефимов. «Сургутнефтегаз» информацию о своих владельцах по-прежнему не раскрывает. «Количество акционеров ОАО “Сургутнефтегаз” — свыше 34 000. Собственники акционеров ОАО “Сургутнефтегаз” нам не известны» — это все, что сообщил «Ведомостям» представитель компании. Зачем компании могло понадобиться кипрское кольцо? «В отсутствие детальной информации сложно судить о содержании операций, реализованных через кипрское кольцо. Можно предположить, что системное симметричное распределение долей участия в нескольких аффилированных компаниях свидетельствует о появлении у “Сургутнефтегаза” нового миноритария с долей менее 1%, — предполагает гендиректор аудиторской фирмы “Старовойтова и партнеры” Елена Старовойтова. — Использование при этом кипрских компаний является достаточно распространенной схемой оптимизации как финансовых потоков, так и налогообложения». Запретов на перекрестное владение в Евросоюзе нет, но такая схема считается непрозрачной, так как позволяет сосредоточить всю власть в руках менеджеров и лишает акционеров возможности влиять на их решения, говорит партнер юридической фирмы White & Case Григорий Чернышов. «Компания, которая торгуется на бирже и заботится о своей инвестиционной привлекательности, такие схемы, как правило, не использует», — добавляет он. Новым миноритарием мог быть нефтетрейдер и давний знакомый российского президента Геннадий Тимченко. В середине 2012 г. он сам признался «Ведомостям», что у него есть акции «Сургутнефтегаза»: «совсем маленький пакет, чуть больше нуля», купленный «то ли за $10 млн, то ли за $5 млн». Представитель Тимченко участие нефтетрейдера в кипрском кольце опровергает: «Геннадий Тимченко владеет мизерной долей в “Сургутнефтегазе”. По нашим оценкам, она составляет около 0,01%. Тимченко не связан ни с одной из упомянутых [кипрских] компаний». Сотрудник одного из адвокатских бюро выдвигает другую версию: «Кольцо фирм на Кипре предположительно может служить для отвода кэша. Или, если кэш там не отводится, может быть техническим каналом для распределения денежных потоков между связанными с кольцом компаниями». - ПРОИСХОЖДЕНИЕ КОЛЬЦА Богданов и его сотрудники в апреле 2006 г. возглавили девять структур, созданных в июле 2002 г. близкими к «Сургутнефтегазу» компаниями. Все эти структуры были зарегистрированы в Сургуте или Сургутском районе и занимались финансовым посредничеством. Объединял их и один телефон, указанный в ЕГРЮЛ. Отвечал по нему сотрудник «Сургутнефтегаза», предположивший, что номер попал в ЕГРЮЛ по ошибке. В 2003 г. эти девять структур получили 263 млрд руб. чистой прибыли, а их долгосрочные финансовые вложения превысили 271 млрд руб. Дальше долгосрочные финансовые вложения росли с такой же динамикой, что и капитализация «Сургутнефтегаза»: они увеличились за 2004 г. на 18,9% (до 323 млрд руб.), в 2005 г. — еще на 52% (491 млрд руб.), а капитализация за то же время — на 20 и 54% соответственно. Это совпадение может указывать на то, что на балансе стоят акции «Сургутнефтегаза», объясняла в 2007 г. Елена Старовойтова. А небольшая разница могла появиться из-за того, что котировки обыкновенных и привилегированных акций менялись по-разному. - 06.05.2013 «Сургутнефтегаз» не раскрыл владельцев компании На счетах «Сургутнефтегаза» более $30 млрд, деньги компания хранит преимущественно в долларах и зарабатывает на депозитах почти $1 млрд в год, следует из ее отчета по МСФО. Но акционеров компания не раскрыл Никаких сюрпризов. Так аналитики и инвесторы комментировали отчетность «Сургутнефтегаза» за 2012 г. по МСФО, опубликованную 30 апреля, и информацию, озвученную менеджментом компании на дне инвестора в Сургуте. Компания не публиковала отчетность по международным стандартам 11 лет и давно не проводила встреч с инвесторами. Поэтому в опубликованной отчетности участники рынка надеялись найти ответы на два главных вопроса: сколько собственных акций и денежных средств на счетах компании и ее «дочек»? Но интерес был удовлетворен лишь наполовину. Именно из-за казначейских акций в 2002 г. разгорелся скандал, когда «Сургутнефтегаз» сообщил в своем отчете по МСФО, что его структурам принадлежит 40,5% уставного капитала (46,6% голосующих акций). Крупнейшие миноритарии подали на компанию в суд, потребовав, чтобы «Сургутнефтегаз» не голосовал этими акциями. С тех пор «Сургут» отчитывался лишь по РСБУ, а публикацию международной отчетности возобновил только по требованию Минфина. Согласно этому отчету, по данным на 31 декабря 2012 г., в собственности «Сургута» находилось лишь 650 000 голосующих акций (менее 1% уставного капитала), или «менее 1% от общего числа акций, выкупленных в 2006 г. за 111 млн руб.». Такой же пакет был у компании и по состоянию на 1 января и 31 декабря 2011 г. Куда делись оставшиеся казначейские акции, в отчете не говорится. На дне инвестора этот вопрос также остался без ответа. Топ-менеджеры компании сказали, что раскрыли все в соответствии с законодательством — данные за последние два года, рассказал старший портфельный управляющий по акциям BNP Paribas Игорь Даниленко. Впрочем, большинство аналитиков прогнозировали, что у «Сургута» вообще не осталось казначейских акций, напоминают в своем обзоре эксперты Deutsche Bank. Еще в начале 2007 г. стало известно, что ООО «Лизинг продакшн», через которое «Сургутнефтегаз» владел большинством казначейских акций (36,77% уставного капитала и 42% голосующих), перешло под контроль НПФ «Сургутнефтегаз». Ситуацию мог бы прояснить гендиректор «Сургута» с 1984 г. Владимир Богданов. Но он даже не пришел на встречу с аналитиками и инвесторами, которые специально прилетели в Сургут, рассказали Даниленко и другие участники встречи (представитель «Сургутнефтегаза» не ответил на звонок «Ведомостей»). Но в целом они остались довольны поездкой в Сургут и на месторождения компании. Поездка была организована на высшем уровне, аналитиков и инвесторов возили [27-30 апреля] на лучшие объекты: на буровые Восточно- и Западносургутского месторождений, газоперерабатывающий завод, а также Талаканское месторождение и новый аэропорт мирового уровня в Талакане, построенный с нуля, рассказывает аналитик «Ренессанс капитала» Ильдар Давлетшин. В отличие от казначейских акций денежные средства расписаны в отчете по МСФО очень подробно. По данным на 31 декабря 2012 г., на счетах «Сургута» их было 920,6 млрд руб. (более $30 млрд), из них на депозитах — 879,6 млрд руб. В отчете по РСБУ приводились схожие цифры — 870,5 млрд и 835,2 млрд руб. соответственно, но эти данные не аудировались и вызвали сомнения, напоминает руководитель аналитического департамента «Открытие капитала» Александр Бурганский. Больше всего денег компания доверила Сбербанку, а из валюты предпочитает доллары, говорится в отчетности (см. графики на стр. 11). Ставки по долларовым депозитам на конец прошлого года составляли 3,64-6,35%, в евро — 3-4,41%, в рублях — 5,18-9,6%. Сумма полученных процентов по депозитам за 2012 г. приблизилась к $1 млрд, достигнув 27,7 млрд руб. (за 2011 г. — 19,4 млрд руб.). За счет того что большая часть денежных средств «Сургута» в иностранной валюте, если произойдет падение рубля относительно доллара, например, на 10%, это увеличит прибыль компании примерно на 81,8 млрд руб., сказано в отчете.  Инвестиции в акции «Сургутнефтегаза» — надежная защита от девальвации рубля, к тому же капитализация компании (1,12 млрд руб.) практически равна сумме средств на ее балансе, поэтому это низкорискованное вложение, отмечает Даниленко. Вот почему публикация отчетности по МСФО и отсутствие в ней казначейских акций не меняют инвестиционную историю компании, считает он. К тому же теперь крупные иностранные фонды, которые раньше не интересовались акциями «Сургутнефтегаза» из-за отсутствия отчетности по международным стандартам, могут обратить на нее внимание, добавляет аналитик Bank of America Merrill Lynch Антон Федотов. Но поскольку главный вопрос о сделках с казначейскими акциями остался без ответа, есть риск, что как собственные бумаги в этой отчетности, так и денежные средства могут исчезнуть в следующей отчетности, предупреждает Давлетшин. После публикации отчетности котировки «Сургутнефтегаза» на Московской бирже пошли вверх. Но по итогам торгов в пятницу обыкновенные акции прибавили 3,76%, а привилегированные — 2,4%. Индекс MICEX вырос на 2,29%.

11 декабря 2013, 16:54

Волкер: я не связан с окончательной версией правила

Бывший председатель ФРС Пол Волкер заявил, что он не имеет отношения к окончательной версии правила, которое носит его имя. Об этом сообщает Bloomberg.

11 декабря 2013, 00:45

Правило Волкера одобрено и вступит в силу в 2015 г.

Пол Волкер, инициатор "правила Волкера" Американские регуляторы одобрили законодательство по ограничению торговой деятельности банков, которое получило название "правило Волкера". Банковские компании отрицают необходимость принятия данных мер и готовят судебные иски против данного закона.  За принятие “правила Волкера” проголосовали все пять регуляторов, которые участвовали в процессе создания данного закона: ФРС США, Комиссии по ценным бумагам и биржам (SEC), Комиссии по торговле товарными фьючерсами (CFTC), Федеральной корпорации по страхованию вкладов (FDIC), свою подпись под проектом закона также поставил глава Управления валютного контролера (OCC). “Правило Волкера” запрещает банковским компаниям участвовать в торговых операциях на финансовых рынках, в том числе “с целью хеджирования рисков”, с использованием собственных средств (proprietary trading). Кроме того, банкам также запрещается увеличивать размеры компенсаций и денежных вознаграждений с целью поощрения подобных операций на финансовом рынке. Впервые с инициативой введения данного законодательства в 2009 г. выступил Пол Волкер, бывший глава ФРС (он занимал этот пост с 1979 по 1987 гг.). По мнению Волкера, повышенная торговая активность банковских компаний США по целому спектру активов стала одной из причин финансового кризиса 2008 г. С данной точкой зрения согласились в администрации президента Обамы, который одобрил начало работы над законопроектом в 2010 г. Однако в своем конечном виде, который был одобрен регуляторами, законопроект появился только 3 с половиной года спустя. Целью данного законодательства является снижение риска для финансовой системы США, а также всей глобальной экономики от торговой активности банков. Одним из громких примеров подобной активности банков в посткризисный период стало дело “Лондонского кита”: из-за рискованной стратегии JP Morgan потерял свыше $6 млрд. “Правило Волкера” начнет функционировать только в 2015 г. Во многом такое решение было принято под давлением банковских компаний, которые активно лоббировали против принятия данного законодательства. По данным некоммерческой организации Sunlight Foundation, в период 2010-2013 гг. наиболее тесно с регуляторами общались именно представители крупных банковских организаций.   За это время представители JP Morgan встречались с регуляторами более 30 раз, Goldman Sachs – более 20 раз. Также свой активный интерес к процессу формирования “правила Волкера” проявили в Bank of America, Morgan Stanley, Bank of New York Mellon, Citigroup, фонде BlackRock и ряде других финансовых компаний. Главы ряда банковских компаний, в частности Брайан Мойнихан из Bank of America Merill Lynch, уже попытались принизить значение данного закона.  BofA: "правило Волкера" ничего не изменит По мнению Мойнихана, "правило Волкера" не окажет заметного влияния на банковский сектор США. Однако при этом банковские компании не оставляют надежд на противодействие нововведению. По информации издания Financial Times, американские банки уже готовят иски против принятия "правила Волкера" (Wall St prepares Volcker rule legal challenges). Ряд экспертов уже поставили под сомнение эффективность "правила Волкера", назвав закон слишком мягким и содержащим слишком много лазеек для продолжения торговых операций банков с использованием собственного капитала. Подобная точка зрения высказывается в издании Forbes (The Volcker Rule Will Not Work). Стоит добавить, что принятие "правила Волкера" многие рассматривают как попытку частичного воссоздания закона Гласса – Стиголла (Glass – Steagall Act). После финансового краха 1929 г., который стал одним из катализаторов Великой депрессии в США, американские власти постарались ограничить спекулятивную активность коммерческих банков. Банкам было запрещено заниматься инвестиционной деятельностью. Были серьезно ограничены их возможности по операциям с ценными бумагами. Закона Гласса – Стиголла действовал в США с 1933 по 1999 гг., пока не был отменен "Законом о финансовой модернизации".

07 декабря 2013, 22:55

Bitcoin как прототип валюты будущего

  Лавина всевозможных новостей, статей, аналитики и прогнозов на тему bitcoin в этом году по своему объему превзошла все, что публиковалось на тему виртуальных валют ранее. Многие уже успели устать от этого и предпочитают не обращать внимания на информационный поток вокруг bitcoin. В этом смысле может показаться, что это “просто еще одна статья” про и без того распиаренную тему. Однако скорее это попытка пробиться сквозь “белый шум” и ответить на вопрос, что несут в себе виртуальные валюты для будущего?  Активное распространение виртуальных валют – примета времени. Такая же как 3D-печать (3D-printing) или дополненная реальность (augmented reality). Технологии, которые совсем недавно были лишь предметом научно-фантастической литературы, в начале XXI века начали обретать реальные очертания. Выдавать прогнозы по поводу будущего может кто угодно, тем более по темам, которые так или иначе идут по зыбкой грани между футурологией и конспирологией. Прогнозы в достаточно больших временных фреймах – дело неблагодарное. Чем больше глубина прогноза по времени, тем выше вероятность ошибок. И все же попробуем сделать несколько шагов вперед, не упасть в грязь лицом, не удариться в крайности и, по возможности, трезво взглянуть на перспективы bitcoin и подобных ему виртуальных валют. Является ли bitcoin деньгами? В первую очередь – что такое деньги? Любая бумажная купюра – это обещание стоимости со стороны Центробанка той или иной страны. Является ли bitcoin и подобные ему виртуальные валюты (litecoin, ripple и другие) в этом смысле деньгами? При всех различиях (в частности, ограничения по размеру эмиссии, открытый-закрытый код и так далее) ни один Центробанк мира не признает их в качестве легального платежного средства. Возможно, подобное признание – это вопрос времени, и финансовые власти просто не смогут игнорировать виртуальные деньги, по мере того как их популярность будет расти?  BofA: bitcoin имеет большой потенциал Аналитики Bank of America Merill Lynch, которые одними из первых среди мировых банковских компаний попытались оценить перспективы bitcoin, считают, что bitcoin в дальнейшем сможет сохранить статус валюты и платежного средства. При этом они также провели аналогии bitcoin с серебром. Энтузиасты bitcoin считают, что подобные сравнения вполне справедливы. Некоторые полагают, что виртуальные валюты вскоре смогут составить конкуренцию мировым валютам. Известный приверженец австрийской школы экономики, член палаты представителей Конгресса США Рон Пол, в частности, в начале декабря 2013 г. в интервью CNN заявил, что “bitcoin может уничтожить доллар” (Ron Paul: Bitcoin could 'destroy the dollar'). Попробуем ответить на более конкретный вопрос: сможет ли bitcoin и подобные ему валюты получить широкое распространение во всем мире? Фактически они уже идут по этому пути. Список компаний, которые принимают bitcoin в качестве платежного средства, постоянно растет. Один из примеров совокупного количества компаний, сайтов и организаций, которые принимают bitcoin – spendbitcoins.com/places/.   За биткойны уже продают автомобили ("Электрокар за криптовалюту"), в ряде кафе в нескольких странах мира за bitcoin можно даже покушать, начали появляться банкоматы, которые позволяют осуществлять операции с биткоинами. Ричард Брэнсон заявил, что готов продать желающим билеты на будущие коммерческие рейсы SpaceShipTwo (справедливости ради, пока не состоялось ни одного, но испытания суборбитального модуля все же продвигаются). Однако как далеко bitcoin сможет пойти, сможет ли она “уничтожить доллар” или хотя бы составить ему конкуренцию? Проблема ограниченной эмиссии, ближайшее будущее Ограничение по максимальному размеру эмиссии – это и преимущество, и недостаток bitсoin, а также подобных ему виртуальных валют. Преимущество заключается в выгодном восприятии данной валюты в отличие от бумажных валют, которые печатаются в неограниченном объеме. Однако при этом финансовая система построена на постоянном увеличении денежной эмиссии. Печатание денег со стороны мировых центробанков де-факто стало одним из способов борьбы с финансовым кризисом.  PIMCO: действия мировых ЦБ ведут к повышению рисков Дракенмиллер: ФРС грабит бедных, помогает богатым Ряд экспертов ставят под сомнение эффективность данной монетарной политики, другие критикуют ее как один из инструментов в “величайшем перераспределении богатства за всю историю человечества”. Но тем не менее это факт, объективная данность текущего развития финансовой системы развитых стран мира. Девальвация национальных валют, которая наглядно прослеживается на примере доллара, идет уже давно, речь идет не о нескольких годах и не только о финансовом кризисе. Графика: American Institute for Economic Research, The AIER Cost-of-Living Guide В более широкой перспективе печатание собственной валюты является одним из способов сохранения конкурентоспособности экономики по отношению к другим странам. Термины “конкурентоспособная девальвация” и “валютные войны” – это также объективная реальность. Что еще более важно, речь идет о стремлении к девальвации валюты для снижения расходов по обслуживанию госдолга отдельных стран. В этом смысле не имеет значения, сможет ли bitcoin действительно "уничтожить" доллар или евро. Важно понимать, что ограниченность в масштабе эмиссии мировой экономике – при текущей модели ее развития – автоматически ограничивает возможности bitcoin в плане замены ведущих мировых валют. Контроль, еще дальше в будущее Заглянем в XXY-нный век. Например, в тот же 2140 г., когда, согласно текущим ограничениям в коде, предполагается, что будет эмитирован последний bitcoin. Возможно, будет принято решение модифицировать код bitcoin, и эмиссия продолжится. Может ли bitcoin трансформироваться в некие безличные “кредиты”?   "Кредитоспособность – вещь добровольная. Она не устанавливается законом. В цивилизованном мире всякой личности предоставлено право решать самой. Я очень сожалею, сэр. — Он поглядел на часы и протянул Коллинзу бумагу, которую просматривал. – Прошу вас взглянуть на этот счет и сказать, всё ли здесь в порядке". Коллинз взял бумагу и прочел: Один дворец с оборудованием 450000000 кр. Услуги такелажников фирмы "Поуха минайл", а также фирмы "Максимо олф" 111000 кр. Сто двадцать две танцовщицы 122000000 кр. Безукоризненное здоровье 888234031 кр. Коллинз быстро пробежал глазами весь счет. Общая сумма слегка превышала восемнадцать миллиардов кредитов". Роберт Шекли, “Кое-что задаром, 1954 г.” Здесь возникает проблема контроля над эмиссией подобной валюты. Интернет кишит всевозможными цитатами о преимуществе контроля за выпуском денег в отдельных странах над законодательной властью. Оставим в стороне теории о выпуске “амеро” или чуть более реального варианта в виде SDR (Special Drawing Rights, специальные права заимствования) от МВФ. Возьмем пример высказывания, атрибуция которого реально подтверждена:    “В течение уже более ста лет идеологические экстремисты на всех концах политического спектра с энтузиазмом ссылаются на некоторые известные события, такие как мой неудачный опыт с Кастро, для того чтобы обвинить семью Рокфеллеров во всеохватывающем угрожающем влиянии, которое, как они заявляют, мы оказываем на американские политические и экономические институты. Некоторые даже верят, что мы являемся частью секретной политической группы, работающей против интересов Соединенных Штатов, и характеризуют мою семью и меня как „интернационалистов“, вступивших в сговор с другими группами по всему миру для построения более интегрированной глобальной политической и экономической структуры – единого мира, если угодно. Если обвинение заключается в этом, то я признаю себя виновным, и я этим горжусь”. Дэвид Рокфеллер, "Мемуары", 2002  Процесс глобализации, так или иначе, продолжается. Проект Евросоюза и его более продвинутая стадия в виде еврозоны – стран, которые отказались от собственных валют в пользу евро, – являются наглядным примером этого. Пока что нет гарантий, что этот проект будет всегда оставаться жизнеспособным. Однако есть и другие примеры. Развитие ВТО в единую систему торговых отношений, в которой нормы данной системы выше норм, установленных в отдельных странах – это также пример глобализации. Структуры в виде МВФ и Всемирного банка, а также всевозможных транснациональных корпораций – это также данность. Перенос производства в развивающиеся страны с более низкими издержками в виде оплаты труда (а также потенциально ближе к новым рынкам сбыта в развивающихся странах) пока также никто не собирается отменять. Тесный симбиоз властных структур и корпораций пока что остается одним из магистральных вариантов развития подобного "нового, дивного мира". В такой системе нет места для широкого использования валюты, которая фактически неподконтрольна никому. Безличные “кредиты” в мире будущего, в котором будут полностью стерты границы государств и исчезнут национальные валюты – если такой мир, не дай бог, когда-либо наступит, – будут жестко контролироваться. Поэтому bitcoin скорее стоит рассматривать как эксперимент в реальном времени, который “определяет рамки дозволенного”. Финансовые власти будут внимательно наблюдать за развитием этого эксперимента. Об этом свидетельствуют комментарии со стороны чиновников ФРС, ЕЦБ, американских сенаторов. В этом свете выводы для bitcoin неутешительны. Мировым финансовым властям и элитам не нужна децентрализованная денежная система с виртуальной криптовалютой, в исходном коде которой изначально заложено ограничение по эмиссии. Саморегулирующаяся финансовая система на основе bitcoin – это чистой воды утопия. В результате, применимо к прогнозам о будущем bitcoin, цитаты вроде "Дайте мне контроль над выпуском денег в государстве, и мне плевать, кто будет писать его законы" более соответствуют реальному положению вещей в мире. При всех своих плюсах и минусах, вероятно, виртуальные валюты и дальше будут оставаться “вещью в себе”, платежными средствами, которые смогут занимать лишь определенные нишевые позиции. Однако отдельные факторы, такие как, например, защищенность кода, вполне могут и, скорее всего, будут использованы властями при валютных нововведениях в будущем. В частности, не исключено, что вместо "вживления чипов" RFID и прочего сатанизма, которым пугают людей, личные данные в виде всевозможных паспортов, водительских прав и прочих документов могли бы быть совмещены с личным кошельком человека – не в виде кредитной карты или биометрических паспортов, а именно в виде кода, который был бы уникальным для каждого человека. Вот только хакеры... Сергей Вафин

27 октября 2013, 17:53

Результаты корп.отчетов и немного о самом масштабном пузыре в истории человечества

В пятницу новый хай установили по рынку? У любого вменяемого человека происходит разрыв шаблона между тем, что происходит вокруг и тем, насколько чудовищным и циничным образом искажается картина действительности в этой матрице. В реальном мире – стагнация доходов рядовых сотрудников на фоне растущей инфляции, высокая безработица и угроза увольнения (8 из 10 крупных компаний в США намереваются сократить персонал, либо, по крайней мере, не увеличивать штат), подавляющая часть компаний сокращает инвестиционную программу и оценку потенциальной выручки в ближайшие 2 года. По всем признакам рецессия. А что у нас в матрице? Триумфальный перехай, т.е. новый исторический максимум по ведущим мировым фондовым индексам. Это какой то совершенно другой мир. Чтобы оправдать все то безумие, которое организовали первичные дилеры в сговоре с ЦБ, то инвест.аналитики придумывают совершенно немыслимые и абсурдные истории «о фундаментальной недооценке акций», «лучшем моменте для входа в рынок за целое поколение», «о том, что акции в долгосрочной перспективе всегда растут», а «перспективы компаний не вызывают опасений», «отчеты лучше прогнозов», «денежная накачка властей делает мир лучше», «экономика уверенно восстанавливается» и прочий бред, которым пестрит лента каждый день, когда индексы устанавливают очередной максимум. Для оценки степени безумия , как обычно следует рассмотреть результаты американских компаний. Как я могу их пропустить, не так ли? )) К пятнице отчитались более, чем достаточно для промежуточных выводов. 21 из 30 компаний в индексе DJI 30 выпустили свои отчеты за 3 квартал. Из тех, кто закрывает квартал в сентябре осталось отчитаться энергетическим и фармацевтическим компаниям в Dow 30 + еще 5, кто закрывает финансовый квартал в октябре. Отмечу, что в конце сентября была произведена ротация индекса, где заменили Alcoa, Bank of America и HP на Goldman Sachs, Nike и Visa, так что со следующего квартала в новом формате, а пока так, как было раньше. Я раньше не публиковал отчеты компаний, чтобы не распылять внимание и энергию впустую. Лучше в одной статье все свести, чем тратить время на 10-15-20 постов. Это позволит сделать комплексную и емкую оценку ситуации.  Итак, ключевые и наиболее важные выводы: 21 компания в Dow 30, которые опубликовали результаты своей деятельности, увеличили выручку к прошлому году на 1.8%, в том году падали на 1.4%. Т.е. отросли от низкой базы. Следовательно, по отношению к 3 кварталу 2011 по настоящий момент выручка выросла на 0.4% (сейчас 375 млрд против 373.5 в 2011 и 368.3 в 2012). 7 из 21 компании сократили выручку к прошлому году. На графике ниже данные по 21 компании, которые выдали результаты.   +1.8% за год и +0.4% за 2 года – это рецессия, т.к. следует учитывать, что общемировой уровень инфляции за 2 года составляет более 6-7%, а в США около 3.2%. Эти корпорации транснациональные, где доля доходов за пределами США достигает 50%, поэтому в реальном выражении продажи падают! В 2007 году за соответствующий период доходы росли на 30%! Пока еще не кризис, т.к. в кризис доходы снижаются на 2-3% на протяжении минимум 3 кварталов, при котором более 85% компании снижают свою годовую выручку. Пока этого нет, но совершенно точно – мы в фазе затяжной рецессии. Среднегодовые темпы прироста доходов для этих компаний в докризисный период составляли 10.5-11%, поэтому в действительности сейчас нет ничего, чтобы напоминало о восстановлении экономической активности. Прибыль компаний сократилась на 4% по отношению к Q3 2012, а год назад прибыль снизилась на 9% к Q3 2011, соответственно, Q3 2013/Q3 2011 чистая прибыль упала более, чем на 13% (!)   Годовая прибыль превысила уровни 2007, однако стагнирует на протяжении 2.5 лет. Прибыль по отношению к первой половине 2011 сейчас находится на том же уровне! Однако в целом по индексу S&P500 наблюдается незначительный рост прибыли на фоне стагнации доходов. Причиной этому является политика оптимизации издержек, главным образом за счет сокращения доли фонда оплаты труда в общих расходах и оптимизации налогооблажения (снижение эффективной налоговой ставки). Т.е. стали меньше платить зарплаты сотрудникам и меньше налогов. Каждый раз, когда номинальная выручка транснациональных гигантов в США падала ниже 2% на протяжении более 4 кварталов подряд, то в США официально начиналась рецессия. Однако этого не видно по оф.статистике ВВП, что скорее свидетельствует о фальсификации макростатистики. Подделать национальные счета в пределах одного стат.ведомства проще, чем подделать отчеты сотен корпораций, что в реальности невозможно не только из-за недопустимости координации жульничества в таком масштабе, но и технически сложно синхронно добиться фальсификации для широкой выборки компаний. В этом плане отчетам корпораций я доверяю больше, чем официальной статистики в США. Корп.отчеты можно воспринимать, как подтверждающий индикатор состояния американской и мировой экономики и как альтернативу оф.статистики. За последние 2 года индекс DJI 30 вырос на 35% (!) по среднемесячным значениям, а S&P500 почти 45% !! Сам по себе столь ожесточенный двухгодичный рост на такую величину редкость. За последние 25 лет такое случалось только один раз (в конце 90-х). В 2010 не учитываем, т.к. шло восстановление от низкой базы. Сейчас же растут от высокой базы. Рост индекса ускорился сразу, как только ухудшились корпоративные результаты, как раз с 4 квартала 2011. Однако, уже совершенно точно можно сказать, что ранее индекс не рос на 35% за 2 года при стагнации годовой выручки, ведь как помним выручка за 2 года не изменилась. Сейчас можно наблюдать тенденцию, что чем хуже результаты, тем сильнее растет индекс. У меня нет квартальных данных по корпорациям раньше 87 года, но судя по годовым историческим рядам в истории американского рынка не было случая, когда бы происходил рост индекса выше 35% за 2 года и до 25% за год при стагнации годовой выручки. В этом контексте масштаб пузыря 2013 не имеет аналогов в истории американского рынка. Т.к. необходимо было оправдывать рост и как то мотивировать инвестдурней на покупку акций американских компаний, то инвест.аналитики и ньюсмейкеры за последние 2 года поддерживали немыслимую по своему масштабу пропагандистскую –агитационную кампанию в поддержку рынка акций, облаченную в запредельный уровень лжи, манипулирование фактами, подмену понятий. Извините, а как еще без вранья/ложных сведений и прогнозов, вводящих в заблуждение можно поддержать весь этот фейк? Супербум на рынке акций, соответствующий экономическому росту на 5-6% в год, против реальной рецессии в экономике? Без принудительного раллирования на рынке акций со стороны ЦБ и дилеров за деньги ФРС, без перекоммутаций глобальных денежных потоков из денежного и долгового рынка в фондовый с помощью продажных аналитиков и информационно-агитационной кампании, без искусственного торпедирования всей этой индустрии за счет исключительно низких ставок по инструментам с фиксированной доходностью, какой бы был уровень S&P 500? В диапазоне 1200-1300 пунктов с учетом текущего состояния балансов контрагентов из реального мира, фактического положения компаний с коррекцией на байбеки и дивы. Да, именно столько, если исключить все манипуляции рынком и искусственную накачку ликвидностью. А значит, имеем пузырь с отклонением рынка от справедливого уровня в 40%, вот и делайте оценку, где может оказаться рынок, если убрать все стимуляторы и допинги. Говоря другими словами, этот 40% разрыв был получен исключительно за счет жульнической, мошеннической политики ЦБ. Низкие ставки по денежному и долговому рынку, при которых фонды вынуждены искать инструменты с большей доходностью для того, чтобы покрыть расходы на ведение бизнеса и выжить. Плюс само по себе приращение ликвидности в системе от QE. P.S. Хотя приз за самый масштабный пузырь в истории человечества скорее можно отдать дотком пузырю конца 90-х (по масштабу и накалу страстей) , но текущий пузырь особенный - он против логики, против реального положения в экономике и против фактических корп.отчетов - это скорее самый масштабный пузырь безумия в истории человечества... 

12 сентября 2013, 12:05

Не мытьем, так катаньем

Американским властям позарез нужно показать, что у них с экономикой все хорошо. И если не получается сделать это нормальным путем, то можно поменять правила игры. Или игроков. 10 сентября индексу DowJones вновь удалось превысить отметку в 15 тысяч пунктов. Правда, список компаний, с помощью которых это было достигнуто, уже несколько отличался от того, что было днем ранее. Все дело в том, что из него выкинули всех неудачников, портящих общую благостную картину, и поместили новые компании, демонстрирующие лучшие результаты. В итоге из индекса DowJones были выброшены алюминиевый гигант Alcoa, небезызвестный Hewlett-Packard, производящий электронику, и никто иной, как BankofAmerica. Вместо них в список вошли банк GoldmanSachs, платежная система Visa и производитель спортивной одежды Nike. Конечно, спортивная одежда оказывает гораздо большее влияние на мировую экономику чем производство какого-то там алюминия. Сейчас в списке DJIA присутствует десять числящихся «производственными» компаний, которые фактически ничего не производят, но ведь все, как известно, зависит от точки зрения. Это для обычного человека собрать из булки, куска сыра и котлеты какой-нибудь гамбургер – это не производство, а вот для биржи – это очень даже производство. Если дело пойдет так и дальше, то вскоре индекс, и так уже довольно сильно оторванный от экономической реальности, может вообще перестать означать хоть что-то вразумительное и окончательно превратится в некую абстракцию, на которую американские власти будут ссылаться, чтобы доказать, что американская экономика наконец-то «восстанавливается». В общем, вновь и очередной раз повторяется та же самая история, что и с сирийским зарином. И чем глубже будет развиваться кризис, тем больше откровенного и наглого вранья властей и их приближенных мы еще услышим. Ну, а индекс… да он поднялся выше 15 тысяч пунктов. И что? Да, кстати. Компания Apple по-прежнему остается одним из любимчиков Уолл-стрита. Да это и неудивительно. Только вчера она с большой помпой выпустила очередной новый продукт, вся ценность которого заключается во встроенном датчике, сканирующем отпечатки пальцев пользователей. Естественно исключительно для удобства пользователей.  Вероятно, эта инновация найдет своих последователей, но самую большую благодарность Apple наверняка скажут АНБ, ЦРУ, ФБР и прочие секретные службы, а также разнообразные правоохранительные органы. Ведь просто заставить сдать человека свои отпечатки пальцев может оказаться непросто, а тут пользователи не только сами и добровольно будут сдавать свои отпечатки, но еще и приплачивать за это. Право слово, решение более чем изящное. Ссылки на мои выступления по телевидению: http://xn--80ajoghfjyj0a.xn--p1ai/zameniteli-deneg-aleksandr-lezhava http://xn--80ajoghfjyj0a.xn--p1ai/kak-doyat-rossiyu-aleksandr-lezhava Мои книжки  «Крах «денег» или как защитить сбережения в условиях кризиса»,  «Золото. Гражданин или государство, свобода или демократия»,  «Занимательная экономика», «Деньги смутных времен. Древняя история»,  «Деньги смутных времен. Московия, Россия и ее соседи в XV – XVIIIвеках»  можно прочитать или скачать по адресу http://www.proza.ru/avtor/mitra396